Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Tmc1'

427100

Institutional Source

Beutler Lab

Gene Symbol

Tmc1

Ensembl Gene

ENSMUSG00000024749

Gene Name

transmembrane channel-like gene family 1

Synonyms

4933416G09Rik, Beethoven, Bth

MMRRC Submission

042995-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.084) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20783458-20954202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 20789622 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 738 (N738K)

Ref Sequence

ENSEMBL: ENSMUSP00000040859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039500]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039500
AA Change: N738K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000040859
Gene: ENSMUSG00000024749
AA Change: N738K

Domain	Start	End	E-Value	Type
SCOP:d1eq1a_	2	95	3e-3	SMART
low complexity region	129	150	N/A	INTRINSIC
transmembrane domain	184	206	N/A	INTRINSIC
transmembrane domain	265	287	N/A	INTRINSIC
low complexity region	295	302	N/A	INTRINSIC
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	431	453	N/A	INTRINSIC
Pfam:TMC	512	627	2.6e-36	PFAM
transmembrane domain	632	654	N/A	INTRINSIC
transmembrane domain	693	715	N/A	INTRINSIC
low complexity region	738	754	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is considered a member of a gene family predicted to encode transmembrane proteins. The specific function of this gene is unknown; however, it is known to be required for normal function of cochlear hair cells. Mutations in this gene have been associated with progressive postlingual hearing loss and profound prelingual deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice are characterized by progressive degeneration of the cochlear inner hair cells and concomitant deafness. Different alleles causing progressive deafness or profound congenital deafness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Btaf1	G	A	19: 36,994,857	V1331I	possibly damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Tmc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01639:Tmc1	APN	19	20816192	missense	probably damaging	1.00
IGL02104:Tmc1	APN	19	20832454	missense	probably benign	0.00
IGL02245:Tmc1	APN	19	20799192	missense	probably damaging	1.00
IGL02544:Tmc1	APN	19	20906963	missense	probably benign	0.04
IGL02699:Tmc1	APN	19	20832350	critical splice donor site	probably null
IGL02974:Tmc1	APN	19	20900844	missense	probably benign
IGL03194:Tmc1	APN	19	20804653	missense	probably damaging	1.00
R0255:Tmc1	UTSW	19	20789587	missense	possibly damaging	0.93
R0381:Tmc1	UTSW	19	20799045	missense	probably damaging	1.00
R0655:Tmc1	UTSW	19	20799176	missense	probably damaging	1.00
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1404:Tmc1	UTSW	19	20816184	missense	possibly damaging	0.79
R1496:Tmc1	UTSW	19	20868355	missense	probably damaging	1.00
R1542:Tmc1	UTSW	19	20816122	missense	probably damaging	1.00
R1773:Tmc1	UTSW	19	20826501	splice site	probably null
R1777:Tmc1	UTSW	19	20816109	critical splice donor site	probably null
R2067:Tmc1	UTSW	19	20824309	missense	possibly damaging	0.90
R2152:Tmc1	UTSW	19	20856675	missense	probably benign	0.01
R2180:Tmc1	UTSW	19	20824084	missense	probably damaging	0.96
R2204:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2205:Tmc1	UTSW	19	20940905	missense	probably benign	0.01
R2285:Tmc1	UTSW	19	20789799	missense	probably damaging	0.96
R4505:Tmc1	UTSW	19	20868374	missense	probably benign	0.00
R4752:Tmc1	UTSW	19	20826649	missense	probably benign	0.35
R4975:Tmc1	UTSW	19	20906955	missense	probably damaging	0.96
R5040:Tmc1	UTSW	19	20824030	missense	possibly damaging	0.68
R5206:Tmc1	UTSW	19	20826660	missense	probably damaging	1.00
R5400:Tmc1	UTSW	19	20804602	missense	probably damaging	1.00
R6200:Tmc1	UTSW	19	20789590	missense	possibly damaging	0.53
R6784:Tmc1	UTSW	19	20827651	critical splice donor site	probably null
R6796:Tmc1	UTSW	19	20799036	missense	probably damaging	1.00
R6808:Tmc1	UTSW	19	20795516	missense	probably damaging	0.99
R6812:Tmc1	UTSW	19	20900861	missense	probably damaging	1.00
R6834:Tmc1	UTSW	19	20795610	nonsense	probably null
R6978:Tmc1	UTSW	19	20804635	missense	probably damaging	1.00
R6986:Tmc1	UTSW	19	20824283	missense	probably benign	0.02
R7027:Tmc1	UTSW	19	20940903	critical splice donor site	probably null
R7378:Tmc1	UTSW	19	20868389	missense	probably damaging	0.98
R7520:Tmc1	UTSW	19	20799178	missense	probably damaging	0.99
R7573:Tmc1	UTSW	19	20907008	missense	probably damaging	0.98
R7825:Tmc1	UTSW	19	20804645	missense	possibly damaging	0.55

Predicted Primers

PCR Primer
(F):5'- TAGATGCTTGGGAAGATCTGAG -3'
(R):5'- AAGCAGCGAATCTGGACCTC -3'

Sequencing Primer
(F):5'- TGCTTGGGAAGATCTGAGATAATG -3'
(R):5'- GCGAATCTGGACCTCAAAAAG -3'

Posted On

2016-09-01