Mutagenetix > Incidental Mutations

Incidental Mutation 'R5429:Btaf1'

427101

Institutional Source

Beutler Lab

Gene Symbol

Btaf1

Ensembl Gene

ENSMUSG00000040565

Gene Name

B-TFIID TATA-box binding protein associated factor 1

Synonyms

E430027O22Rik

MMRRC Submission

042995-MU

Accession Numbers

Genbank: NM_001080706

Is this an essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R5429 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36926079-37012752 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 36994857 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 1331 (V1331I)

Ref Sequence

ENSEMBL: ENSMUSP00000097093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099494]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099494
AA Change: V1331I

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: V1331I

Domain	Start	End	E-Value	Type
low complexity region	87	98	N/A	INTRINSIC
low complexity region	143	152	N/A	INTRINSIC
PDB:3OC3\|B	276	414	3e-6	PDB
low complexity region	438	454	N/A	INTRINSIC
Pfam:DUF3535	585	1051	1.1e-133	PFAM
low complexity region	1099	1110	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
DEXDc	1261	1469	3.02e-30	SMART
low complexity region	1630	1641	N/A	INTRINSIC
HELICc	1657	1743	2.22e-19	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]

Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	G	A	13: 66,431,828	P199S	probably benign	Het
Akap13	T	G	7: 75,602,904	S261A	possibly damaging	Het
Ankrd34a	G	A	3: 96,597,521	G14R	probably damaging	Het
Auts2	G	A	5: 131,472,335	T289M	probably damaging	Het
Ciz1	T	A	2: 32,376,043	I609K	possibly damaging	Het
Clca3b	C	T	3: 144,846,459	V154I	probably damaging	Het
Csde1	A	G	3: 103,052,841	T564A	possibly damaging	Het
Csrnp2	A	G	15: 100,482,054	V452A	probably benign	Het
Ctnnd1	C	T	2: 84,616,789	V371M	probably damaging	Het
Dock6	T	C	9: 21,832,881	D677G	probably damaging	Het
Filip1l	A	T	16: 57,570,255	E402V	probably damaging	Het
Gad1-ps	G	A	10: 99,445,147		noncoding transcript	Het
Ghr	G	A	15: 3,388,675	Q37*	probably null	Het
Gm10770	C	T	2: 150,179,423	R58H	probably benign	Het
Gm12789	T	C	4: 101,989,961	Y148H	possibly damaging	Het
Herc4	T	A	10: 63,275,013	N234K	probably benign	Het
Itih3	A	G	14: 30,923,521	V10A	probably benign	Het
Kat14	T	A	2: 144,393,323	D234E	probably benign	Het
Kif13a	A	G	13: 46,772,769		probably null	Het
Kif2b	A	G	11: 91,577,229	V76A	probably benign	Het
Mboat1	A	G	13: 30,219,667	T150A	probably benign	Het
Mfsd1	T	A	3: 67,599,960	L398H	probably damaging	Het
Myt1l	G	A	12: 29,832,332	G509R	unknown	Het
Nfx1	T	C	4: 41,004,343	C705R	probably damaging	Het
Olfr318	T	A	11: 58,720,524	N175Y	probably damaging	Het
Olfr60	A	G	7: 140,345,273	F239L	possibly damaging	Het
Pcdh10	T	C	3: 45,384,200	S931P	probably benign	Het
Pdpk1	T	C	17: 24,091,560	E205G	probably benign	Het
Ppp2r2a	A	T	14: 67,023,756	F172I	probably damaging	Het
Ppp2r5e	T	A	12: 75,453,763	D452V	probably damaging	Het
Rims2	A	T	15: 39,345,355	T185S	probably damaging	Het
Rpusd4	T	C	9: 35,272,602	V209A	probably benign	Het
Safb	T	C	17: 56,588,822	V20A	probably benign	Het
Scaf8	C	A	17: 3,197,110	P903T	probably benign	Het
Slc30a7	A	G	3: 116,006,925	S31P	possibly damaging	Het
Slc9b1	T	C	3: 135,373,263		probably null	Het
Sntb1	C	G	15: 55,642,795	G461R	probably damaging	Het
Tbc1d32	T	C	10: 56,027,993	D1226G	probably damaging	Het
Tlnrd1	G	T	7: 83,882,314	T303N	probably damaging	Het
Tmc1	G	T	19: 20,789,622	N738K	possibly damaging	Het
Tmem41a	A	G	16: 21,934,856	I255T	probably benign	Het
Trim7	G	A	11: 48,849,955	C293Y	probably damaging	Het
Trpc6	C	T	9: 8,634,074	Q385*	probably null	Het
Ttc39b	A	G	4: 83,243,953	I330T	possibly damaging	Het
Vil1	C	T	1: 74,432,331	T757I	probably benign	Het
Zfp462	T	C	4: 55,060,077	V1201A	probably damaging	Het
Zfp473	T	A	7: 44,732,848	E686V	possibly damaging	Het

Other mutations in Btaf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Btaf1	APN	19	37009702	missense	probably damaging	1.00
IGL00535:Btaf1	APN	19	36997535	missense	probably damaging	1.00
IGL00574:Btaf1	APN	19	36969930	missense	probably benign	0.00
IGL00969:Btaf1	APN	19	37011252	splice site	probably benign
IGL01325:Btaf1	APN	19	37004649	splice site	probably benign
IGL01399:Btaf1	APN	19	37000170	nonsense	probably null
IGL02024:Btaf1	APN	19	36992426	splice site	probably benign
IGL02471:Btaf1	APN	19	37000192	missense	probably damaging	0.96
IGL02664:Btaf1	APN	19	36978428	splice site	probably benign
IGL02898:Btaf1	APN	19	36969068	missense	probably benign
IGL02995:Btaf1	APN	19	36981135	splice site	probably benign
IGL03023:Btaf1	APN	19	37010015	missense	possibly damaging	0.85
IGL03188:Btaf1	APN	19	36949108	missense	possibly damaging	0.91
IGL03353:Btaf1	APN	19	36992500	missense	probably damaging	1.00
freudenberg	UTSW	19	36988173	critical splice donor site	probably null
Galanos	UTSW	19	36949102	missense	probably damaging	1.00
3-1:Btaf1	UTSW	19	37010078	missense	probably damaging	1.00
R0013:Btaf1	UTSW	19	36958373	missense	probably benign
R0048:Btaf1	UTSW	19	37003524	missense	probably benign	0.01
R0117:Btaf1	UTSW	19	36969968	missense	probably benign	0.06
R0207:Btaf1	UTSW	19	37009648	nonsense	probably null
R0310:Btaf1	UTSW	19	37004534	missense	probably damaging	0.96
R0377:Btaf1	UTSW	19	36989002	missense	probably benign
R0419:Btaf1	UTSW	19	36945229	missense	probably damaging	0.99
R0440:Btaf1	UTSW	19	36986653	missense	probably damaging	0.99
R0532:Btaf1	UTSW	19	36951186	splice site	probably benign
R0612:Btaf1	UTSW	19	36969137	missense	probably damaging	0.99
R0731:Btaf1	UTSW	19	36997495	splice site	probably null
R0780:Btaf1	UTSW	19	36988922	missense	probably damaging	0.99
R0919:Btaf1	UTSW	19	36990743	missense	probably benign	0.03
R1104:Btaf1	UTSW	19	37004602	missense	probably damaging	1.00
R1263:Btaf1	UTSW	19	36956524	missense	probably benign	0.10
R1325:Btaf1	UTSW	19	36969162	missense	possibly damaging	0.68
R1447:Btaf1	UTSW	19	36992454	missense	probably benign	0.00
R1554:Btaf1	UTSW	19	36996598	missense	probably benign	0.02
R1649:Btaf1	UTSW	19	36981722	missense	probably benign
R1715:Btaf1	UTSW	19	36969121	missense	probably damaging	0.99
R1733:Btaf1	UTSW	19	36994962	missense	probably benign
R1764:Btaf1	UTSW	19	36951118	missense	probably benign	0.12
R1874:Btaf1	UTSW	19	36980583	missense	probably benign
R1911:Btaf1	UTSW	19	36986630	missense	probably benign
R1933:Btaf1	UTSW	19	36972957	missense	probably damaging	1.00
R2080:Btaf1	UTSW	19	36951148	missense	probably benign	0.09
R2483:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R2510:Btaf1	UTSW	19	37002445	missense	probably benign	0.08
R3623:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3624:Btaf1	UTSW	19	36981086	missense	probably benign	0.02
R3801:Btaf1	UTSW	19	36986548	missense	probably benign
R3801:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3802:Btaf1	UTSW	19	36986548	missense	probably benign
R3802:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R3803:Btaf1	UTSW	19	36986548	missense	probably benign
R3803:Btaf1	UTSW	19	36988973	missense	probably benign	0.00
R4077:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4079:Btaf1	UTSW	19	36986479	missense	probably benign	0.00
R4133:Btaf1	UTSW	19	36961738	missense	probably benign	0.00
R4673:Btaf1	UTSW	19	36978372	missense	probably benign	0.00
R4731:Btaf1	UTSW	19	36981078	missense	probably benign	0.03
R4796:Btaf1	UTSW	19	36956428	missense	possibly damaging	0.95
R4824:Btaf1	UTSW	19	36981048	missense	possibly damaging	0.84
R4835:Btaf1	UTSW	19	37002458	missense	probably benign	0.00
R4837:Btaf1	UTSW	19	36966785	missense	probably benign
R4925:Btaf1	UTSW	19	37011333	missense	probably benign
R4968:Btaf1	UTSW	19	36969951	missense	probably null	0.71
R4976:Btaf1	UTSW	19	36986579	missense	probably benign
R5001:Btaf1	UTSW	19	36986652	missense	possibly damaging	0.90
R5037:Btaf1	UTSW	19	37003531	missense	probably damaging	1.00
R5039:Btaf1	UTSW	19	36990762	missense	probably benign
R5211:Btaf1	UTSW	19	36996562	missense	probably benign	0.32
R5422:Btaf1	UTSW	19	36951107	missense	probably benign	0.09
R5530:Btaf1	UTSW	19	36990775	missense	possibly damaging	0.85
R5582:Btaf1	UTSW	19	36988173	critical splice donor site	probably null
R5654:Btaf1	UTSW	19	36983615	missense	probably benign	0.35
R5744:Btaf1	UTSW	19	37004490	missense	probably benign	0.02
R6082:Btaf1	UTSW	19	36983542	missense	probably damaging	1.00
R6243:Btaf1	UTSW	19	36981120	missense	probably benign	0.02
R6291:Btaf1	UTSW	19	36973008	missense	probably benign	0.00
R6502:Btaf1	UTSW	19	36983617	missense	probably benign
R7034:Btaf1	UTSW	19	37004469	missense	probably benign
R7036:Btaf1	UTSW	19	37004469	missense	probably benign
R7085:Btaf1	UTSW	19	36972918	missense	probably benign
R7097:Btaf1	UTSW	19	36949102	missense	probably damaging	1.00
R7248:Btaf1	UTSW	19	36945314	missense	possibly damaging	0.54
R7386:Btaf1	UTSW	19	36958382	missense	probably benign	0.02
R7402:Btaf1	UTSW	19	37003515	missense	probably damaging	1.00
R7452:Btaf1	UTSW	19	36969127	missense	probably damaging	1.00
R7493:Btaf1	UTSW	19	37009605	missense	probably damaging	1.00
R7513:Btaf1	UTSW	19	36978403	missense	probably benign	0.30
W0251:Btaf1	UTSW	19	37003504	missense	probably damaging	1.00
X0027:Btaf1	UTSW	19	36949096	nonsense	probably null
Z1088:Btaf1	UTSW	19	36986618	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCATTCTAGCAGGAGATCAC -3'
(R):5'- ACCATTTTCTTAAGCTAGGTCTCTGG -3'

Sequencing Primer
(F):5'- CATTCTAGCAGGAGATCACTGTCAG -3'
(R):5'- AAGCTAGGTCTCTGGGTCTAATTC -3'

Posted On

2016-09-01