Incidental Mutation 'R5430:Olfr1258'
ID427108
Institutional Source Beutler Lab
Gene Symbol Olfr1258
Ensembl Gene ENSMUSG00000049149
Gene Nameolfactory receptor 1258
SynonymsGA_x6K02T2Q125-51361752-51362687, MOR232-3
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5430 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89927309-89936334 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89929913 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 35 (I35F)
Ref Sequence ENSEMBL: ENSMUSP00000149547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102609] [ENSMUST00000111516] [ENSMUST00000213720]
Predicted Effect probably benign
Transcript: ENSMUST00000102609
AA Change: I35F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099669
Gene: ENSMUSG00000049149
AA Change: I35F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 6.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111516
AA Change: I35F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000107141
Gene: ENSMUSG00000049149
AA Change: I35F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 4.9e-32 PFAM
Pfam:7tm_4 137 278 2.7e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213720
AA Change: I35F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Olfr1258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1258 APN 2 89930544 missense probably damaging 0.96
IGL02552:Olfr1258 APN 2 89930559 missense probably benign 0.01
IGL03300:Olfr1258 APN 2 89930227 nonsense probably null
R0081:Olfr1258 UTSW 2 89930079 missense possibly damaging 0.90
R0197:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0701:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0883:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R1163:Olfr1258 UTSW 2 89930105 missense possibly damaging 0.78
R1833:Olfr1258 UTSW 2 89930301 nonsense probably null
R1846:Olfr1258 UTSW 2 89930666 missense possibly damaging 0.45
R4504:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4507:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4679:Olfr1258 UTSW 2 89930664 missense possibly damaging 0.63
R4908:Olfr1258 UTSW 2 89930579 missense probably benign 0.00
R6836:Olfr1258 UTSW 2 89930339 missense probably damaging 1.00
R7552:Olfr1258 UTSW 2 89930720 missense probably benign 0.06
R7709:Olfr1258 UTSW 2 89929881 missense probably benign 0.00
R8060:Olfr1258 UTSW 2 89930349 missense probably benign 0.04
R8349:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
R8449:Olfr1258 UTSW 2 89930534 missense possibly damaging 0.48
Z1177:Olfr1258 UTSW 2 89930598 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCAAATGGAATTGAAACACTCG -3'
(R):5'- ACCTGGGTCATGCATCCATTG -3'

Sequencing Primer
(F):5'- AAACACTCGTTTGTTTGCTTGTTTG -3'
(R):5'- CCTGGGTCATGCATCCATTGAATAG -3'
Posted On2016-09-01