Incidental Mutation 'R5430:Ankrd34a'
ID427113
Institutional Source Beutler Lab
Gene Symbol Ankrd34a
Ensembl Gene ENSMUSG00000049097
Gene Nameankyrin repeat domain 34A
SynonymsAnkrd34
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5430 (G1)
Quality Score221
Status Validated
Chromosome3
Chromosomal Location96596636-96599775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 96597521 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 14 (G14R)
Ref Sequence ENSEMBL: ENSMUSP00000102707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058943] [ENSMUST00000062058] [ENSMUST00000091924] [ENSMUST00000145001]
Predicted Effect probably damaging
Transcript: ENSMUST00000058943
AA Change: G14R

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102707
Gene: ENSMUSG00000049097
AA Change: G14R

DomainStartEndE-ValueType
ANK 4 33 9.05e2 SMART
ANK 37 72 2.81e-4 SMART
ANK 76 106 5.84e-2 SMART
ANK 110 139 7.99e2 SMART
low complexity region 216 244 N/A INTRINSIC
low complexity region 350 366 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062058
SMART Domains Protein: ENSMUSP00000057623
Gene: ENSMUSG00000049288

DomainStartEndE-ValueType
Pfam:LIX1 80 328 8.9e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091924
SMART Domains Protein: ENSMUSP00000089544
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 217 2.8e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145001
SMART Domains Protein: ENSMUSP00000118943
Gene: ENSMUSG00000028104

DomainStartEndE-ValueType
Pfam:RNA_pol_3_Rpc31 1 148 4.4e-31 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Ankrd34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Ankrd34a APN 3 96598913 missense probably benign 0.33
R0190:Ankrd34a UTSW 3 96597789 missense probably damaging 0.99
R1940:Ankrd34a UTSW 3 96598676 missense probably benign 0.28
R3779:Ankrd34a UTSW 3 96598931 missense possibly damaging 0.85
R5427:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R5429:Ankrd34a UTSW 3 96597521 missense probably damaging 0.99
R6129:Ankrd34a UTSW 3 96597958 nonsense probably null
R6621:Ankrd34a UTSW 3 96598215 missense possibly damaging 0.91
R6891:Ankrd34a UTSW 3 96598019 missense probably benign 0.00
R6951:Ankrd34a UTSW 3 96598422 missense possibly damaging 0.77
R7085:Ankrd34a UTSW 3 96598629 missense probably benign
R7478:Ankrd34a UTSW 3 96598500 missense possibly damaging 0.65
R8257:Ankrd34a UTSW 3 96597729 missense possibly damaging 0.93
R8746:Ankrd34a UTSW 3 96597475 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTCGTTCATCGGTGCCTCAG -3'
(R):5'- CTAAACGGTCTGCGATGTTGGG -3'

Sequencing Primer
(F):5'- CTGAGCCTGTCAGTAAGCTC -3'
(R):5'- CTGCGATGTTGGGATCCGC -3'
Posted On2016-09-01