Incidental Mutation 'R5430:Melk'
ID427116
Institutional Source Beutler Lab
Gene Symbol Melk
Ensembl Gene ENSMUSG00000035683
Gene Namematernal embryonic leucine zipper kinase
SynonymsMPK38
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5430 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44300876-44364675 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44309033 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 130 (H130R)
Ref Sequence ENSEMBL: ENSMUSP00000043806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045607] [ENSMUST00000125708] [ENSMUST00000137703]
PDB Structure The crystal structure of mouse PK38 [X-RAY DIFFRACTION]
The crystal structure of MPK38 in complex with OTSSP167, an orally- administrative MELK selective inhibitor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000045607
AA Change: H130R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043806
Gene: ENSMUSG00000035683
AA Change: H130R

DomainStartEndE-ValueType
S_TKc 11 263 2.64e-105 SMART
low complexity region 313 325 N/A INTRINSIC
Pfam:KA1 599 643 2.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118668
Predicted Effect probably benign
Transcript: ENSMUST00000125708
SMART Domains Protein: ENSMUSP00000118359
Gene: ENSMUSG00000035683

DomainStartEndE-ValueType
Pfam:Pkinase 11 91 1.9e-15 PFAM
Pfam:Pkinase_Tyr 11 97 4.3e-10 PFAM
Pfam:Pkinase 88 134 6.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137703
SMART Domains Protein: ENSMUSP00000120242
Gene: ENSMUSG00000035683

DomainStartEndE-ValueType
Pfam:Pkinase 11 88 7.7e-15 PFAM
Pfam:Pkinase_Tyr 11 88 3.1e-9 PFAM
Pfam:Pkinase_Tyr 87 212 1.5e-15 PFAM
Pfam:Pkinase 87 215 3.4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137759
Meta Mutation Damage Score 0.9673 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Mice homozygous for an allele that produces a kinase-dead protein exhibit altered pancreatic regeneration following injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Melk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Melk APN 4 44347262 missense probably benign 0.05
IGL01367:Melk APN 4 44332907 missense possibly damaging 0.62
IGL01865:Melk APN 4 44344988 missense probably benign 0.00
IGL02801:Melk APN 4 44360930 missense probably damaging 0.99
R0037:Melk UTSW 4 44360864 splice site probably benign
R0433:Melk UTSW 4 44340614 splice site probably benign
R0570:Melk UTSW 4 44308906 missense probably damaging 1.00
R0786:Melk UTSW 4 44303649 missense unknown
R1483:Melk UTSW 4 44308937 missense probably damaging 1.00
R2042:Melk UTSW 4 44309051 critical splice donor site probably null
R3831:Melk UTSW 4 44345021 missense probably benign 0.05
R5060:Melk UTSW 4 44350959 missense probably benign 0.15
R5236:Melk UTSW 4 44344959 missense probably benign
R5269:Melk UTSW 4 44363730 missense probably damaging 1.00
R5357:Melk UTSW 4 44363730 missense probably damaging 1.00
R5358:Melk UTSW 4 44363730 missense probably damaging 1.00
R5360:Melk UTSW 4 44363730 missense probably damaging 1.00
R5576:Melk UTSW 4 44312255 missense probably null 1.00
R5656:Melk UTSW 4 44312237 missense possibly damaging 0.95
R5738:Melk UTSW 4 44310333 missense probably damaging 1.00
R5972:Melk UTSW 4 44351007 missense probably benign 0.01
R6265:Melk UTSW 4 44318109 missense probably damaging 1.00
R6340:Melk UTSW 4 44340633 missense probably damaging 1.00
R7202:Melk UTSW 4 44351106 missense probably benign
R7242:Melk UTSW 4 44360885 missense probably damaging 1.00
R7328:Melk UTSW 4 44332931 missense probably benign
R7608:Melk UTSW 4 44325571 splice site probably null
R8053:Melk UTSW 4 44318109 missense probably damaging 1.00
R8185:Melk UTSW 4 44360965 missense probably benign 0.14
R8356:Melk UTSW 4 44312191 missense possibly damaging 0.75
R8456:Melk UTSW 4 44312191 missense possibly damaging 0.75
X0020:Melk UTSW 4 44349876 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCCATTCCTGGGAAGTGATTTC -3'
(R):5'- TCTTGACAAAGGGCAGCTATAATG -3'

Sequencing Primer
(F):5'- CATTCCTGGGAAGTGATTTCTGTAAC -3'
(R):5'- AGGGCAGCTATAATGTCATGTAC -3'
Posted On2016-09-01