Incidental Mutation 'R5430:Brsk1'
ID427127
Institutional Source Beutler Lab
Gene Symbol Brsk1
Ensembl Gene ENSMUSG00000035390
Gene NameBR serine/threonine kinase 1
SynonymsSAD-B, LOC381979
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5430 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4690604-4715997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4710436 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 702 (F702L)
Ref Sequence ENSEMBL: ENSMUSP00000039517 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048248] [ENSMUST00000086364] [ENSMUST00000120836]
Predicted Effect probably benign
Transcript: ENSMUST00000048248
AA Change: F702L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039517
Gene: ENSMUSG00000035390
AA Change: F702L

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 13 30 N/A INTRINSIC
S_TKc 34 285 6.75e-103 SMART
low complexity region 330 344 N/A INTRINSIC
low complexity region 430 457 N/A INTRINSIC
low complexity region 492 517 N/A INTRINSIC
low complexity region 523 552 N/A INTRINSIC
low complexity region 668 686 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086364
SMART Domains Protein: ENSMUSP00000083550
Gene: ENSMUSG00000046456

DomainStartEndE-ValueType
Pfam:Frag1 4 114 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120836
AA Change: F627L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113448
Gene: ENSMUSG00000035390
AA Change: F627L

DomainStartEndE-ValueType
S_TKc 1 210 1.19e-71 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
low complexity region 448 477 N/A INTRINSIC
low complexity region 593 611 N/A INTRINSIC
low complexity region 671 689 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123637
AA Change: F18L
Meta Mutation Damage Score 0.4305 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
MGI Phenotype PHENOTYPE: Homozygous mutant mice are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Brsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Brsk1 APN 7 4704261 missense probably benign 0.03
IGL01733:Brsk1 APN 7 4706072 missense probably damaging 1.00
IGL03019:Brsk1 APN 7 4710497 intron probably benign
IGL03088:Brsk1 APN 7 4710454 intron probably benign
R0612:Brsk1 UTSW 7 4707426 missense possibly damaging 0.96
R0891:Brsk1 UTSW 7 4704227 missense possibly damaging 0.95
R1455:Brsk1 UTSW 7 4704251 missense probably damaging 1.00
R1728:Brsk1 UTSW 7 4704219 missense probably damaging 1.00
R2884:Brsk1 UTSW 7 4691123 unclassified probably benign
R2939:Brsk1 UTSW 7 4708140 missense possibly damaging 0.53
R4392:Brsk1 UTSW 7 4698750 missense probably damaging 1.00
R4661:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4662:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4756:Brsk1 UTSW 7 4708867 missense possibly damaging 0.72
R4788:Brsk1 UTSW 7 4698955 splice site probably null
R5026:Brsk1 UTSW 7 4704266 missense probably damaging 1.00
R5248:Brsk1 UTSW 7 4708866 missense possibly damaging 0.53
R5267:Brsk1 UTSW 7 4704709 missense probably damaging 1.00
R5419:Brsk1 UTSW 7 4709004 missense possibly damaging 0.53
R5625:Brsk1 UTSW 7 4706400 missense probably damaging 1.00
R5659:Brsk1 UTSW 7 4715372 missense possibly damaging 0.93
R6700:Brsk1 UTSW 7 4692701 missense probably damaging 0.99
R6866:Brsk1 UTSW 7 4706407 missense probably damaging 0.98
R7169:Brsk1 UTSW 7 4715404 missense probably benign
R8404:Brsk1 UTSW 7 4706696 missense probably damaging 0.98
R8893:Brsk1 UTSW 7 4708090 missense probably damaging 0.98
Z1088:Brsk1 UTSW 7 4707372 missense possibly damaging 0.96
Z1177:Brsk1 UTSW 7 4704222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTAAGTGCAGGATAGAGAGC -3'
(R):5'- ATCTATTCCCAACAGTGCAGGG -3'

Sequencing Primer
(F):5'- GACGACAGTCTTGCTTGT -3'
(R):5'- GGAGACCTCAGCAAGACACTG -3'
Posted On2016-09-01