Incidental Mutation 'R5430:Slc38a8'
ID427133
Institutional Source Beutler Lab
Gene Symbol Slc38a8
Ensembl Gene ENSMUSG00000034224
Gene Namesolute carrier family 38, member 8
SynonymsLOC234788
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R5430 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location119479602-119501698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119494220 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 200 (I200T)
Ref Sequence ENSEMBL: ENSMUSP00000119987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036748] [ENSMUST00000133821] [ENSMUST00000138061]
Predicted Effect probably benign
Transcript: ENSMUST00000036748
AA Change: I200T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038438
Gene: ENSMUSG00000034224
AA Change: I200T

DomainStartEndE-ValueType
Pfam:Aa_trans 22 429 3.7e-58 PFAM
Pfam:Trp_Tyr_perm 23 264 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132838
SMART Domains Protein: ENSMUSP00000121251
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Aa_trans 39 289 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133821
SMART Domains Protein: ENSMUSP00000123094
Gene: ENSMUSG00000034224

DomainStartEndE-ValueType
Pfam:Trp_Tyr_perm 22 163 2.1e-10 PFAM
Pfam:Aa_trans 22 165 3.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138061
AA Change: I200T

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119987
Gene: ENSMUSG00000034224
AA Change: I200T

DomainStartEndE-ValueType
Pfam:Aa_trans 22 202 2.2e-25 PFAM
Pfam:Trp_Tyr_perm 23 196 1.2e-9 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a putative sodium-dependent amino-acid/proton antiporter. The protein has eleven transmembrane domains, an extracellular N-terminus and an intracellular C-terminal tail. The protein is a member of the SLC38 sodium-coupled neutral amino acid transporter family of proteins. Mutations in this gene result in foveal hypoplasia with or without optic nerve misrouting and/or anterior segment dysgenesis. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Slc38a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Slc38a8 APN 8 119494219 missense probably benign 0.01
IGL02167:Slc38a8 APN 8 119487360 missense probably benign 0.03
IGL02565:Slc38a8 APN 8 119485561 missense probably damaging 1.00
IGL02899:Slc38a8 APN 8 119485543 missense probably benign 0.34
IGL03177:Slc38a8 APN 8 119485512 missense probably damaging 1.00
IGL03282:Slc38a8 APN 8 119499716 missense probably damaging 0.99
R1109:Slc38a8 UTSW 8 119482655 missense probably benign
R1116:Slc38a8 UTSW 8 119496133 missense probably damaging 1.00
R2247:Slc38a8 UTSW 8 119485650 missense probably benign 0.00
R4964:Slc38a8 UTSW 8 119482684 splice site probably null
R5294:Slc38a8 UTSW 8 119494289 missense probably damaging 1.00
R5303:Slc38a8 UTSW 8 119486041 missense possibly damaging 0.66
R5643:Slc38a8 UTSW 8 119480749 makesense probably null
R6016:Slc38a8 UTSW 8 119494305 splice site probably null
R7346:Slc38a8 UTSW 8 119499815 nonsense probably null
R7425:Slc38a8 UTSW 8 119485588 missense possibly damaging 0.89
R7502:Slc38a8 UTSW 8 119501081 missense possibly damaging 0.60
R8081:Slc38a8 UTSW 8 119485530 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- AGCCCACTGTTCTCTAAGCC -3'
(R):5'- TCAGGAACAGAGCATCCTGG -3'

Sequencing Primer
(F):5'- TGTCAGCTTCCACATAGACAGTGG -3'
(R):5'- ATCCTGGCTCCATCCTAGGG -3'
Posted On2016-09-01