Incidental Mutation 'R5430:Olfr720'
ID427144
Institutional Source Beutler Lab
Gene Symbol Olfr720
Ensembl Gene ENSMUSG00000052417
Gene Nameolfactory receptor 720
SynonymsMOR274-2, GA_x6K02T2PLTE-6544896-6543946
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R5430 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14171738-14186838 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14175692 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 130 (R130H)
Ref Sequence ENSEMBL: ENSMUSP00000149641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035250] [ENSMUST00000206298] [ENSMUST00000206298] [ENSMUST00000216079] [ENSMUST00000217642]
Predicted Effect probably benign
Transcript: ENSMUST00000035250
AA Change: R130H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046509
Gene: ENSMUSG00000052417
AA Change: R130H

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 8.4e-49 PFAM
Pfam:7tm_1 40 289 8.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206298
AA Change: R130H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206298
AA Change: R130H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000216079
AA Change: R130H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000217642
AA Change: R130H

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Olfr720
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02658:Olfr720 APN 14 14175732 missense possibly damaging 0.92
IGL02704:Olfr720 APN 14 14175483 missense probably benign 0.00
IGL03308:Olfr720 APN 14 14175161 missense probably benign
IGL03331:Olfr720 APN 14 14176017 missense probably benign 0.16
R0008:Olfr720 UTSW 14 14176092 start gained probably benign
R0131:Olfr720 UTSW 14 14175620 missense probably benign 0.03
R0647:Olfr720 UTSW 14 14175858 missense probably benign 0.35
R0747:Olfr720 UTSW 14 14175429 missense probably benign 0.01
R1210:Olfr720 UTSW 14 14176029 missense probably benign 0.00
R1225:Olfr720 UTSW 14 14175600 missense possibly damaging 0.89
R1525:Olfr720 UTSW 14 14175725 missense probably damaging 1.00
R1975:Olfr720 UTSW 14 14175446 missense probably damaging 1.00
R1994:Olfr720 UTSW 14 14175854 missense probably benign 0.16
R2310:Olfr720 UTSW 14 14175836 missense probably benign 0.03
R3151:Olfr720 UTSW 14 14175203 missense probably damaging 1.00
R4547:Olfr720 UTSW 14 14175854 missense probably damaging 0.99
R4824:Olfr720 UTSW 14 14175885 missense probably damaging 1.00
R5063:Olfr720 UTSW 14 14175593 missense probably damaging 1.00
R5098:Olfr720 UTSW 14 14175683 missense probably benign 0.03
R5512:Olfr720 UTSW 14 14175633 missense probably damaging 1.00
R5748:Olfr720 UTSW 14 14175314 missense probably damaging 1.00
R7200:Olfr720 UTSW 14 14175477 missense probably damaging 1.00
R7407:Olfr720 UTSW 14 14175402 missense probably benign
R7666:Olfr720 UTSW 14 14176075 missense probably benign
R7760:Olfr720 UTSW 14 14175905 missense probably damaging 1.00
R8118:Olfr720 UTSW 14 14175863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCTTTGTCACCACAGGC -3'
(R):5'- ATGTGCCACGTTCTTCATGG -3'

Sequencing Primer
(F):5'- AGGCCAGCCTCAGCATTG -3'
(R):5'- CCATATTGGCAAATGGGGTTATGATC -3'
Posted On2016-09-01