Incidental Mutation 'R5430:Gm11127'
ID427152
Institutional Source Beutler Lab
Gene Symbol Gm11127
Ensembl Gene ENSMUSG00000079492
Gene Namepredicted gene 11127
Synonyms
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5430 (G1)
Quality Score147
Status Not validated
Chromosome17
Chromosomal Location36055816-36058371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36056075 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 359 (V359I)
Ref Sequence ENSEMBL: ENSMUSP00000109371 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097331] [ENSMUST00000113742]
Predicted Effect probably benign
Transcript: ENSMUST00000097331
SMART Domains Protein: ENSMUSP00000094943
Gene: ENSMUSG00000073407

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113742
AA Change: V359I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109371
Gene: ENSMUSG00000079492
AA Change: V359I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:MHC_I 26 204 6.4e-81 PFAM
IGc1 220 291 2.53e-23 SMART
transmembrane domain 306 328 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn1r238 G T 18: 3,122,521 L298M possibly damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Gm11127
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01859:Gm11127 APN 17 36058011 missense possibly damaging 0.78
IGL02007:Gm11127 APN 17 36056330 missense possibly damaging 0.50
R1075:Gm11127 UTSW 17 36056146 missense probably benign 0.05
R1829:Gm11127 UTSW 17 36058004 missense probably damaging 1.00
R1944:Gm11127 UTSW 17 36058005 missense probably damaging 1.00
R4117:Gm11127 UTSW 17 36057604 missense probably damaging 1.00
R4584:Gm11127 UTSW 17 36057667 missense probably damaging 1.00
R4626:Gm11127 UTSW 17 36057896 frame shift probably null
R4649:Gm11127 UTSW 17 36057876 missense possibly damaging 0.90
R4864:Gm11127 UTSW 17 36058361 utr 3 prime probably benign
R5412:Gm11127 UTSW 17 36056044 missense probably benign 0.01
R5547:Gm11127 UTSW 17 36057904 missense possibly damaging 0.63
R5896:Gm11127 UTSW 17 36056344 missense probably benign 0.01
R5974:Gm11127 UTSW 17 36056785 missense probably benign 0.05
R6456:Gm11127 UTSW 17 36056610 missense probably damaging 1.00
R7073:Gm11127 UTSW 17 36058343 missense unknown
R7217:Gm11127 UTSW 17 36056343 missense probably benign 0.01
R7652:Gm11127 UTSW 17 36056783 missense probably damaging 1.00
R8267:Gm11127 UTSW 17 36056783 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TACATCTTCAGGAGCCAGGGTG -3'
(R):5'- CGCACCAATCATTGCTACTGTC -3'

Sequencing Primer
(F):5'- GCCAGGGTGCAGGAAGC -3'
(R):5'- ACCAATCATTGCTACTGTCTTTAAC -3'
Posted On2016-09-01