Incidental Mutation 'R5430:Vmn1r238'
ID427154
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Namevomeronasal 1 receptor, 238
Synonyms
MMRRC Submission 042996-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5430 (G1)
Quality Score189
Status Validated
Chromosome18
Chromosomal Location3122492-3123412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3122521 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 298 (L298M)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165255
AA Change: L298M

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: L298M

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency 96% (54/56)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J11Rik T A 9: 40,052,291 noncoding transcript Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ankrd34a G A 3: 96,597,521 G14R probably damaging Het
Arhgef1 C A 7: 24,912,307 probably null Het
Brsk1 T C 7: 4,710,436 F702L probably benign Het
Chrna3 C T 9: 55,012,908 V470I probably damaging Het
Cpm A G 10: 117,676,081 Q310R possibly damaging Het
Dennd5a T C 7: 109,934,240 T108A probably damaging Het
Dvl3 C T 16: 20,523,731 R145W probably damaging Het
E4f1 G A 17: 24,444,970 A532V probably damaging Het
Eid1 A G 2: 125,673,630 T147A probably damaging Het
Eipr1 A T 12: 28,863,016 N239Y probably damaging Het
Eml5 T C 12: 98,794,158 I1777M probably damaging Het
Gm11127 C T 17: 36,056,075 V359I probably benign Het
Gm11787 A T 4: 3,512,786 noncoding transcript Het
Gnat2 T C 3: 108,098,400 L227P probably damaging Het
Jag1 T C 2: 137,101,706 H190R possibly damaging Het
Kdm7a A G 6: 39,149,342 W570R possibly damaging Het
Lmbrd1 A G 1: 24,692,980 T93A possibly damaging Het
Lrch4 T C 5: 137,638,533 S433P possibly damaging Het
Lrp1 G A 10: 127,541,061 R4216W probably damaging Het
Magohb A G 6: 131,289,418 Y42H probably damaging Het
Melk A G 4: 44,309,033 H130R probably damaging Het
Mettl24 G T 10: 40,737,784 R173L probably benign Het
Mup4 A T 4: 59,960,044 H73Q probably damaging Het
Mylk2 A T 2: 152,917,548 E386V probably damaging Het
Nppb C T 4: 147,986,381 P71L probably benign Het
Oca2 T C 7: 56,295,460 V272A probably damaging Het
Olfr1258 A T 2: 89,929,913 I35F probably benign Het
Olfr127 T A 17: 37,904,413 I289N probably damaging Het
Olfr720 C T 14: 14,175,692 R130H probably benign Het
Osbpl6 T C 2: 76,586,138 S628P probably damaging Het
Papola T C 12: 105,809,584 V253A probably damaging Het
Pex12 T C 11: 83,297,746 D141G probably damaging Het
Ppm1k A T 6: 57,524,886 C97* probably null Het
Ptprh T A 7: 4,551,047 E807V probably damaging Het
Sema3a A T 5: 13,565,763 T385S probably damaging Het
Sfn T C 4: 133,601,627 Y48C probably damaging Het
Slc38a8 A G 8: 119,494,220 I200T probably benign Het
Smarcal1 T C 1: 72,626,617 V758A probably damaging Het
Stmn4 A G 14: 66,358,014 M190V possibly damaging Het
Syt3 T G 7: 44,390,913 L190R possibly damaging Het
Tbl1xr1 T A 3: 22,192,082 D255E probably benign Het
Ttbk2 C T 2: 120,777,565 R191H probably damaging Het
Vmn2r45 A C 7: 8,483,334 Y318* probably null Het
Vsig8 T C 1: 172,559,629 I24T probably damaging Het
Wdr3 G A 3: 100,157,327 T166I possibly damaging Het
Zfp354c A G 11: 50,815,195 I351T probably benign Het
Zfp52 A G 17: 21,555,067 T8A probably benign Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R3024:Vmn1r238 UTSW 18 3123305 missense probably benign 0.13
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
R8325:Vmn1r238 UTSW 18 3122529 missense probably benign 0.00
R8423:Vmn1r238 UTSW 18 3123365 nonsense probably null
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCACAAAATTTTCTACTGATCATTCC -3'
(R):5'- CTGAAAGTCTCACCTGAAGACAGAG -3'

Sequencing Primer
(F):5'- GTTTTAGCATTGTGTAACAGA -3'
(R):5'- AAACTATCCTCATCCTGCTGTG -3'
Posted On2016-09-01