Incidental Mutation 'R5441:Car1'
ID427164
Institutional Source Beutler Lab
Gene Symbol Car1
Ensembl Gene ENSMUSG00000027556
Gene Namecarbonic anhydrase 1
SynonymsCar-1, CA I
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location14766216-14808368 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 14776304 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 90 (R90G)
Ref Sequence ENSEMBL: ENSMUSP00000137926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094365] [ENSMUST00000144327] [ENSMUST00000181860]
Predicted Effect probably damaging
Transcript: ENSMUST00000094365
AA Change: R90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091925
Gene: ENSMUSG00000027556
AA Change: R90G

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144327
AA Change: R24G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120495
Gene: ENSMUSG00000027556
AA Change: R24G

DomainStartEndE-ValueType
Carb_anhydrase 6 92 2.08e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181860
AA Change: R90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137926
Gene: ENSMUSG00000027556
AA Change: R90G

DomainStartEndE-ValueType
Carb_anhydrase 6 261 2e-133 SMART
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: This locus controls electrophoretic variation in red blood cells. The a allele determines a slow migrating form in C57BL/6, C3H/He and other strains; the b allele determines a fast form in IS/Cam, WB/Re, SM, M. m. castaneus and M. m. molossinus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Car1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Car1 APN 3 14767459 missense probably benign 0.00
IGL02975:Car1 APN 3 14777822 missense probably benign 0.31
R0432:Car1 UTSW 3 14770176 missense probably benign 0.03
R1637:Car1 UTSW 3 14777786 missense possibly damaging 0.81
R2244:Car1 UTSW 3 14770852 missense possibly damaging 0.50
R5036:Car1 UTSW 3 14776239 missense possibly damaging 0.86
R5038:Car1 UTSW 3 14770873 missense probably damaging 1.00
R7477:Car1 UTSW 3 14776283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTGACCTTTGAAGCGTTC -3'
(R):5'- AACATAATCAGGAAGGCACTGTATG -3'

Sequencing Primer
(F):5'- ACCTTTGAAGCGTTCTGAGAG -3'
(R):5'- TCAGGAAGGCACTGTATGTATAATAG -3'
Posted On2016-09-01