Mutagenetix > Incidental Mutation

Incidental Mutation 'R5441:Rpe65'

427166

Institutional Source

Beutler Lab

Gene Symbol

Rpe65

Ensembl Gene

ENSMUSG00000028174

Gene Name

retinal pigment epithelium 65

Synonyms

A930029L06Rik, Mord1, rd12

MMRRC Submission

043006-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.243) question?

Stock #

R5441 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

159599175-159625321 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 159604401 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 104 (G104C)

Ref Sequence

ENSEMBL: ENSMUSP00000143654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029824] [ENSMUST00000196999] [ENSMUST00000197771]

AlphaFold

Q91ZQ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000029824
AA Change: G104C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029824
Gene: ENSMUSG00000028174
AA Change: G104C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000196999
AA Change: G104C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143654
Gene: ENSMUSG00000028174
AA Change: G104C

Domain	Start	End	E-Value	Type
Pfam:RPE65	15	532	1.4e-111	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197771

SMART Domains

Protein: ENSMUSP00000143390
Gene: ENSMUSG00000028174

Domain	Start	End	E-Value	Type
Pfam:RPE65	13	109	5.8e-19	PFAM

Meta Mutation Damage Score

0.9529

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is located in the retinal pigment epithelium and is involved in the production of 11-cis retinal and in visual pigment regeneration. There are two forms of this protein, a soluble form called sRPE65, and a palmitoylated, membrane-bound form known as mRPE65. mRPE65 serves as the palmitoyl donor for lecithin retinol acyl transferase (LRAT), the enzyme that catalyzes the vitamin A to all trans retinol step of the chromophore regeneration process. Both mRPE65 and sRPE65 also serve as regulatory proteins, with the ratio and concentrations of these molecules playing a role in the inhibition of 11-cis retinal synthesis. Mutations in this gene have been associated with Leber congenital amaurosis type 2 (LCA2) and retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants exhibit disorganized outer segment discs, reduced rod function, lack of rhodopsin and lipofuscin flurophores, and over-accumulation of all-trans-retinyl esters in the retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	T	7: 28,156,914	T2042M	probably damaging	Het
Abca12	A	G	1: 71,295,056	Y1096H	probably damaging	Het
Aspa	A	T	11: 73,305,594	F261I	probably damaging	Het
Atm	C	A	9: 53,516,467	G448*	probably null	Het
Atmin	T	A	8: 116,957,957	D785E	probably damaging	Het
C87414	A	T	5: 93,636,597	M139K	possibly damaging	Het
Car1	G	C	3: 14,776,304	R90G	probably damaging	Het
Cdh11	T	C	8: 102,647,546	D520G	probably benign	Het
Cers5	T	A	15: 99,751,238	K50*	probably null	Het
Chad	A	T	11: 94,568,292	D340V	probably benign	Het
Cspg5	T	C	9: 110,246,643	I68T	probably benign	Het
Fcrla	T	A	1: 170,925,422		probably benign	Het
Fer1l4	T	A	2: 156,023,257	D1608V	probably benign	Het
Fzd5	T	A	1: 64,735,417	Q395L	probably benign	Het
Gm7664	T	A	13: 62,528,650		probably benign	Het
Hk3	T	C	13: 55,015,056	E2G	probably damaging	Het
Hmcn2	G	A	2: 31,406,416	E2677K	possibly damaging	Het
Hydin	T	C	8: 110,565,109	L3411P	possibly damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Lysmd2	C	T	9: 75,625,972	H70Y	possibly damaging	Het
Msi2	A	G	11: 88,479,992		probably benign	Het
Msi2	G	A	11: 88,718,095		probably benign	Het
Napsa	T	A	7: 44,581,393		probably benign	Het
Nlrp4a	T	A	7: 26,454,153	L710M	probably damaging	Het
Olfr1025-ps1	T	A	2: 85,918,590	F222I	probably benign	Het
Olfr103	T	C	17: 37,336,268		probably null	Het
Olfr1510	T	A	14: 52,409,957	K305M	probably benign	Het
Olfr459	C	T	6: 41,771,848	M150I	probably benign	Het
Olfr522	T	C	7: 140,162,651	T100A	probably benign	Het
Plbd2	T	A	5: 120,499,082	Y105F	probably benign	Het
Plppr5	A	T	3: 117,662,471	I214F	possibly damaging	Het
Ptcd3	A	G	6: 71,881,521	V655A	possibly damaging	Het
Ptpn14	T	C	1: 189,798,570	L78P	probably damaging	Het
Ralgapa1	A	C	12: 55,719,623	D1295E	probably damaging	Het
Rnf213	G	A	11: 119,409,020	D192N	probably damaging	Het
Ropn1	A	G	16: 34,666,797	I34M	probably damaging	Het
Scgb2b27	T	C	7: 34,013,157		probably benign	Het
Sh3bgr	T	C	16: 96,205,917	I29T	possibly damaging	Het
Smg1	T	C	7: 118,195,081		probably benign	Het
Stim2	T	A	5: 54,075,370	C68*	probably null	Het
Syne2	G	A	12: 75,989,143	V3736I	possibly damaging	Het
Tbx19	T	C	1: 165,153,680	N82D	probably damaging	Het
Tdp1	T	A	12: 99,910,285	V353D	probably damaging	Het
Tg	T	A	15: 66,696,520	I1352K	possibly damaging	Het
Thsd4	T	C	9: 59,979,783	T919A	probably damaging	Het
Tmprss11f	A	T	5: 86,528,203	M373K	probably damaging	Het
Tmprss15	T	A	16: 79,071,447		probably null	Het
Tpd52	A	T	3: 9,003,406	Y16*	probably null	Het
Ube2o	G	A	11: 116,544,442	R507C	probably damaging	Het
Unc93b1	T	C	19: 3,943,703	F382L	probably benign	Het
Vav2	A	T	2: 27,270,110		probably benign	Het
Vmn1r207-ps	T	C	13: 22,726,516		noncoding transcript	Het
Zan	T	A	5: 137,436,751	I2127F	unknown	Het
Zfp748	C	A	13: 67,540,618	C841F	probably damaging	Het
Zic4	C	A	9: 91,384,200	P299Q	probably damaging	Het

Other mutations in Rpe65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Rpe65	APN	3	159614542	missense	probably damaging	0.99
IGL01446:Rpe65	APN	3	159600405	splice site	probably benign
IGL01815:Rpe65	APN	3	159604530	splice site	probably null
IGL02085:Rpe65	APN	3	159615646	missense	probably benign	0.00
IGL02232:Rpe65	APN	3	159604351	missense	possibly damaging	0.93
IGL02248:Rpe65	APN	3	159624705	missense	probably damaging	1.00
IGL02645:Rpe65	APN	3	159606491	missense	probably damaging	0.99
IGL02711:Rpe65	APN	3	159622877	missense	possibly damaging	0.84
IGL02982:Rpe65	APN	3	159600361	missense	probably damaging	0.99
IGL03280:Rpe65	APN	3	159604341	missense	probably damaging	0.96
IGL03350:Rpe65	APN	3	159614517	missense	possibly damaging	0.75
IGL03356:Rpe65	APN	3	159615577	missense	possibly damaging	0.89
I1329:Rpe65	UTSW	3	159624723	missense	probably benign	0.35
R0571:Rpe65	UTSW	3	159600349	missense	probably damaging	1.00
R0905:Rpe65	UTSW	3	159601583	missense	possibly damaging	0.95
R1024:Rpe65	UTSW	3	159606485	missense	probably benign	0.07
R1597:Rpe65	UTSW	3	159614784	missense	probably damaging	0.97
R1657:Rpe65	UTSW	3	159614448	missense	probably damaging	0.97
R1778:Rpe65	UTSW	3	159622848	missense	probably damaging	1.00
R1970:Rpe65	UTSW	3	159615670	missense	probably benign
R2259:Rpe65	UTSW	3	159615571	missense	probably damaging	1.00
R3012:Rpe65	UTSW	3	159604563	missense	possibly damaging	0.61
R3923:Rpe65	UTSW	3	159604400	missense	probably benign	0.16
R3975:Rpe65	UTSW	3	159604585	missense	probably damaging	1.00
R4204:Rpe65	UTSW	3	159604410	missense	probably damaging	0.99
R4825:Rpe65	UTSW	3	159624681	missense	probably benign
R4924:Rpe65	UTSW	3	159622631	missense	probably benign	0.01
R5269:Rpe65	UTSW	3	159604347	missense	probably benign	0.07
R5324:Rpe65	UTSW	3	159604404	missense	possibly damaging	0.94
R5854:Rpe65	UTSW	3	159615676	missense	probably benign
R5907:Rpe65	UTSW	3	159615682	critical splice donor site	probably null
R6149:Rpe65	UTSW	3	159614143	missense	probably benign
R6660:Rpe65	UTSW	3	159614708	missense	probably damaging	0.98
R6830:Rpe65	UTSW	3	159614168	missense	probably benign	0.06
R7025:Rpe65	UTSW	3	159622685	missense	probably damaging	1.00
R7092:Rpe65	UTSW	3	159615591	missense	probably damaging	1.00
R7203:Rpe65	UTSW	3	159622854	missense	probably damaging	0.99
R7366:Rpe65	UTSW	3	159624729	missense	probably benign	0.13
R7537:Rpe65	UTSW	3	159604609	missense	probably damaging	0.98
R7679:Rpe65	UTSW	3	159604393	missense	probably damaging	1.00
R8044:Rpe65	UTSW	3	159614705	missense	probably benign
R8179:Rpe65	UTSW	3	159624699	missense	probably benign	0.06
R8409:Rpe65	UTSW	3	159614148	missense	probably benign	0.01
R8558:Rpe65	UTSW	3	159614792	missense	probably damaging	1.00
R9042:Rpe65	UTSW	3	159615655	missense	probably damaging	1.00
R9483:Rpe65	UTSW	3	159622681	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTCTCTATCACCGGCTTGG -3'
(R):5'- AGTAATCTTCTCCCACTGGGTAG -3'

Sequencing Primer
(F):5'- ACCGGCTTGGGGAGATTC -3'
(R):5'- CTCCCACTGGGTAGATATTTACAAGG -3'

Posted On

2016-09-01