Incidental Mutation 'R5441:Ptcd3'
ID427173
Institutional Source Beutler Lab
Gene Symbol Ptcd3
Ensembl Gene ENSMUSG00000063884
Gene Namepentatricopeptide repeat domain 3
Synonyms2610034F17Rik, 2810422B04Rik
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location71880638-71908750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71881521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 655 (V655A)
Ref Sequence ENSEMBL: ENSMUSP00000080743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082094] [ENSMUST00000206879] [ENSMUST00000207003]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082094
AA Change: V655A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000080743
Gene: ENSMUSG00000063884
AA Change: V655A

DomainStartEndE-ValueType
low complexity region 2 8 N/A INTRINSIC
low complexity region 216 227 N/A INTRINSIC
Pfam:PPR_2 253 300 1.4e-10 PFAM
Pfam:PPR_3 331 366 2.1e-4 PFAM
low complexity region 671 684 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205269
Predicted Effect probably benign
Transcript: ENSMUST00000205628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206762
Predicted Effect probably benign
Transcript: ENSMUST00000206879
Predicted Effect probably benign
Transcript: ENSMUST00000207003
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Ptcd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Ptcd3 APN 6 71903448 missense probably damaging 0.96
IGL00903:Ptcd3 APN 6 71907844 missense possibly damaging 0.93
IGL01545:Ptcd3 APN 6 71888577 missense probably benign 0.01
IGL01924:Ptcd3 APN 6 71898427 missense probably damaging 1.00
IGL02675:Ptcd3 APN 6 71883442 critical splice donor site probably null
R0732:Ptcd3 UTSW 6 71881171 unclassified probably benign
R1374:Ptcd3 UTSW 6 71908653 nonsense probably null
R1393:Ptcd3 UTSW 6 71889621 missense probably benign 0.00
R1498:Ptcd3 UTSW 6 71893495 missense probably damaging 1.00
R1646:Ptcd3 UTSW 6 71898395 missense probably benign 0.26
R1712:Ptcd3 UTSW 6 71908653 nonsense probably null
R2022:Ptcd3 UTSW 6 71885553 missense probably damaging 1.00
R2248:Ptcd3 UTSW 6 71894285 critical splice donor site probably null
R2406:Ptcd3 UTSW 6 71888647 missense probably damaging 1.00
R3418:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R3419:Ptcd3 UTSW 6 71883486 missense possibly damaging 0.93
R4677:Ptcd3 UTSW 6 71893514 missense probably benign 0.17
R4741:Ptcd3 UTSW 6 71902949 missense probably damaging 1.00
R4752:Ptcd3 UTSW 6 71901312 missense probably damaging 0.99
R5583:Ptcd3 UTSW 6 71902936 missense probably damaging 1.00
R5681:Ptcd3 UTSW 6 71907659 missense probably damaging 1.00
R6028:Ptcd3 UTSW 6 71898408 missense probably damaging 1.00
R6324:Ptcd3 UTSW 6 71885327 missense probably benign 0.00
R6537:Ptcd3 UTSW 6 71897110 splice site probably null
R6600:Ptcd3 UTSW 6 71883546 missense probably damaging 1.00
R6783:Ptcd3 UTSW 6 71908643 missense probably benign 0.00
R6810:Ptcd3 UTSW 6 71885532 missense probably damaging 0.99
R6860:Ptcd3 UTSW 6 71897110 splice site probably null
R6993:Ptcd3 UTSW 6 71885315 missense probably damaging 1.00
R7578:Ptcd3 UTSW 6 71908707 missense probably benign
X0024:Ptcd3 UTSW 6 71901274 missense probably damaging 1.00
X0065:Ptcd3 UTSW 6 71907806 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGTCATAGCAGTTTTCAAAGCAG -3'
(R):5'- CATTGGGTACAGTTCAGTTTTGCC -3'

Sequencing Primer
(F):5'- CCAAACTGCACTGAACTATTATGAG -3'
(R):5'- GTTCAGTTTTGCCTTCTTTTATACAG -3'
Posted On2016-09-01