Incidental Mutation 'R5441:Smg1'
ID 427179
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik, C130002K18Rik
MMRRC Submission 043006-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5441 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 117730531-117842893 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) T to C at 117794304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: I523M
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: I523M

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208930
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A G 1: 71,334,215 (GRCm39) Y1096H probably damaging Het
Aspa A T 11: 73,196,420 (GRCm39) F261I probably damaging Het
Atm C A 9: 53,427,767 (GRCm39) G448* probably null Het
Atmin T A 8: 117,684,696 (GRCm39) D785E probably damaging Het
Car1 G C 3: 14,841,364 (GRCm39) R90G probably damaging Het
Cdh11 T C 8: 103,374,178 (GRCm39) D520G probably benign Het
Cers5 T A 15: 99,649,119 (GRCm39) K50* probably null Het
Chad A T 11: 94,459,118 (GRCm39) D340V probably benign Het
Cspg5 T C 9: 110,075,711 (GRCm39) I68T probably benign Het
Fcgbpl1 C T 7: 27,856,339 (GRCm39) T2042M probably damaging Het
Fcrla T A 1: 170,752,991 (GRCm39) probably benign Het
Fer1l4 T A 2: 155,865,177 (GRCm39) D1608V probably benign Het
Fzd5 T A 1: 64,774,576 (GRCm39) Q395L probably benign Het
Gm7664 T A 13: 62,676,464 (GRCm39) probably benign Het
Hk3 T C 13: 55,162,869 (GRCm39) E2G probably damaging Het
Hmcn2 G A 2: 31,296,428 (GRCm39) E2677K possibly damaging Het
Hydin T C 8: 111,291,741 (GRCm39) L3411P possibly damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Lysmd2 C T 9: 75,533,254 (GRCm39) H70Y possibly damaging Het
Msi2 A G 11: 88,370,818 (GRCm39) probably benign Het
Msi2 G A 11: 88,608,921 (GRCm39) probably benign Het
Napsa T A 7: 44,230,817 (GRCm39) probably benign Het
Nlrp4a T A 7: 26,153,578 (GRCm39) L710M probably damaging Het
Or10g1 T A 14: 52,647,414 (GRCm39) K305M probably benign Het
Or12d13 T C 17: 37,647,159 (GRCm39) probably null Het
Or5m13 T A 2: 85,748,934 (GRCm39) F222I probably benign Het
Or6ae1 T C 7: 139,742,564 (GRCm39) T100A probably benign Het
Or9a2 C T 6: 41,748,782 (GRCm39) M150I probably benign Het
Plbd2 T A 5: 120,637,147 (GRCm39) Y105F probably benign Het
Plppr5 A T 3: 117,456,120 (GRCm39) I214F possibly damaging Het
Pramel34 A T 5: 93,784,456 (GRCm39) M139K possibly damaging Het
Ptcd3 A G 6: 71,858,505 (GRCm39) V655A possibly damaging Het
Ptpn14 T C 1: 189,530,767 (GRCm39) L78P probably damaging Het
Ralgapa1 A C 12: 55,766,408 (GRCm39) D1295E probably damaging Het
Rnf213 G A 11: 119,299,846 (GRCm39) D192N probably damaging Het
Ropn1 A G 16: 34,487,167 (GRCm39) I34M probably damaging Het
Rpe65 G T 3: 159,310,038 (GRCm39) G104C probably damaging Het
Scgb2b27 T C 7: 33,712,582 (GRCm39) probably benign Het
Sh3bgr T C 16: 96,007,117 (GRCm39) I29T possibly damaging Het
Stim2 T A 5: 54,232,712 (GRCm39) C68* probably null Het
Syne2 G A 12: 76,035,917 (GRCm39) V3736I possibly damaging Het
Tbx19 T C 1: 164,981,249 (GRCm39) N82D probably damaging Het
Tdp1 T A 12: 99,876,544 (GRCm39) V353D probably damaging Het
Tg T A 15: 66,568,369 (GRCm39) I1352K possibly damaging Het
Thsd4 T C 9: 59,887,066 (GRCm39) T919A probably damaging Het
Tmprss11f A T 5: 86,676,062 (GRCm39) M373K probably damaging Het
Tmprss15 T A 16: 78,868,335 (GRCm39) probably null Het
Tpd52 A T 3: 9,068,466 (GRCm39) Y16* probably null Het
Ube2o G A 11: 116,435,268 (GRCm39) R507C probably damaging Het
Unc93b1 T C 19: 3,993,703 (GRCm39) F382L probably benign Het
Vav2 A T 2: 27,160,122 (GRCm39) probably benign Het
Vmn1r207 T C 13: 22,910,686 (GRCm39) noncoding transcript Het
Zan T A 5: 137,435,013 (GRCm39) I2127F unknown Het
Zfp748 C A 13: 67,688,737 (GRCm39) C841F probably damaging Het
Zic4 C A 9: 91,266,253 (GRCm39) P299Q probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 117,797,494 (GRCm39) utr 3 prime probably benign
IGL00481:Smg1 APN 7 117,810,017 (GRCm39) missense possibly damaging 0.67
IGL00503:Smg1 APN 7 117,784,706 (GRCm39) utr 3 prime probably benign
IGL00927:Smg1 APN 7 117,739,855 (GRCm39) missense probably damaging 1.00
IGL01333:Smg1 APN 7 117,762,601 (GRCm39) splice site probably benign
IGL01344:Smg1 APN 7 117,790,059 (GRCm39) utr 3 prime probably benign
IGL01397:Smg1 APN 7 117,762,444 (GRCm39) utr 3 prime probably benign
IGL01403:Smg1 APN 7 117,757,355 (GRCm39) utr 3 prime probably benign
IGL01573:Smg1 APN 7 117,767,185 (GRCm39) utr 3 prime probably benign
IGL01872:Smg1 APN 7 117,748,167 (GRCm39) utr 3 prime probably benign
IGL02010:Smg1 APN 7 117,785,369 (GRCm39) utr 3 prime probably benign
IGL02158:Smg1 APN 7 117,812,169 (GRCm39) missense possibly damaging 0.77
IGL02268:Smg1 APN 7 117,781,764 (GRCm39) missense probably benign 0.19
IGL02314:Smg1 APN 7 117,753,932 (GRCm39) utr 3 prime probably benign
IGL02552:Smg1 APN 7 117,795,117 (GRCm39) utr 3 prime probably benign
IGL02577:Smg1 APN 7 117,802,345 (GRCm39) missense probably damaging 0.99
IGL02859:Smg1 APN 7 117,748,156 (GRCm39) utr 3 prime probably benign
IGL02890:Smg1 APN 7 117,784,724 (GRCm39) utr 3 prime probably benign
IGL02892:Smg1 APN 7 117,767,178 (GRCm39) utr 3 prime probably benign
IGL03119:Smg1 APN 7 117,794,336 (GRCm39) utr 3 prime probably benign
IGL03123:Smg1 APN 7 117,756,404 (GRCm39) utr 3 prime probably benign
IGL03128:Smg1 APN 7 117,802,282 (GRCm39) missense probably benign 0.03
IGL03184:Smg1 APN 7 117,779,603 (GRCm39) missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 117,784,764 (GRCm39) missense unknown
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0098:Smg1 UTSW 7 117,744,690 (GRCm39) missense probably benign 0.02
R0139:Smg1 UTSW 7 117,751,898 (GRCm39) critical splice donor site probably null
R0371:Smg1 UTSW 7 117,767,523 (GRCm39) utr 3 prime probably benign
R0415:Smg1 UTSW 7 117,781,691 (GRCm39) missense probably benign 0.34
R0416:Smg1 UTSW 7 117,783,684 (GRCm39) splice site probably benign
R0423:Smg1 UTSW 7 117,776,103 (GRCm39) missense possibly damaging 0.53
R0600:Smg1 UTSW 7 117,759,606 (GRCm39) utr 3 prime probably benign
R0626:Smg1 UTSW 7 117,781,606 (GRCm39) missense possibly damaging 0.82
R0627:Smg1 UTSW 7 117,767,084 (GRCm39) utr 3 prime probably benign
R0727:Smg1 UTSW 7 117,765,645 (GRCm39) utr 3 prime probably benign
R0729:Smg1 UTSW 7 117,745,512 (GRCm39) utr 3 prime probably benign
R0841:Smg1 UTSW 7 117,742,524 (GRCm39) missense possibly damaging 0.96
R1114:Smg1 UTSW 7 117,759,013 (GRCm39) utr 3 prime probably benign
R1256:Smg1 UTSW 7 117,802,310 (GRCm39) missense probably damaging 1.00
R1298:Smg1 UTSW 7 117,767,434 (GRCm39) utr 3 prime probably benign
R1370:Smg1 UTSW 7 117,758,975 (GRCm39) utr 3 prime probably benign
R1591:Smg1 UTSW 7 117,756,142 (GRCm39) utr 3 prime probably benign
R1736:Smg1 UTSW 7 117,765,190 (GRCm39) splice site probably null
R1755:Smg1 UTSW 7 117,802,287 (GRCm39) nonsense probably null
R1765:Smg1 UTSW 7 117,738,938 (GRCm39) missense probably benign 0.03
R1789:Smg1 UTSW 7 117,745,021 (GRCm39) missense possibly damaging 0.73
R1845:Smg1 UTSW 7 117,753,845 (GRCm39) utr 3 prime probably benign
R1908:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1909:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1942:Smg1 UTSW 7 117,757,326 (GRCm39) utr 3 prime probably benign
R2064:Smg1 UTSW 7 117,756,090 (GRCm39) utr 3 prime probably benign
R2072:Smg1 UTSW 7 117,762,389 (GRCm39) utr 3 prime probably benign
R2154:Smg1 UTSW 7 117,757,299 (GRCm39) utr 3 prime probably benign
R2895:Smg1 UTSW 7 117,788,366 (GRCm39) utr 3 prime probably benign
R2915:Smg1 UTSW 7 117,810,102 (GRCm39) splice site probably benign
R3416:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3417:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3873:Smg1 UTSW 7 117,753,885 (GRCm39) utr 3 prime probably benign
R4082:Smg1 UTSW 7 117,759,469 (GRCm39) utr 3 prime probably benign
R4230:Smg1 UTSW 7 117,747,956 (GRCm39) critical splice donor site probably null
R4304:Smg1 UTSW 7 117,738,741 (GRCm39) missense probably benign 0.03
R4549:Smg1 UTSW 7 117,758,906 (GRCm39) utr 3 prime probably benign
R4571:Smg1 UTSW 7 117,738,688 (GRCm39) missense possibly damaging 0.72
R4638:Smg1 UTSW 7 117,795,149 (GRCm39) utr 3 prime probably benign
R4642:Smg1 UTSW 7 117,753,487 (GRCm39) utr 3 prime probably benign
R4656:Smg1 UTSW 7 117,812,174 (GRCm39) missense probably benign 0.00
R4754:Smg1 UTSW 7 117,755,954 (GRCm39) utr 3 prime probably benign
R4798:Smg1 UTSW 7 117,779,697 (GRCm39) missense probably benign 0.32
R4906:Smg1 UTSW 7 117,751,631 (GRCm39) utr 3 prime probably benign
R4978:Smg1 UTSW 7 117,753,470 (GRCm39) utr 3 prime probably benign
R4989:Smg1 UTSW 7 117,807,274 (GRCm39) missense probably benign
R4989:Smg1 UTSW 7 117,757,323 (GRCm39) utr 3 prime probably benign
R5026:Smg1 UTSW 7 117,792,768 (GRCm39) utr 3 prime probably benign
R5124:Smg1 UTSW 7 117,812,235 (GRCm39) missense probably benign 0.00
R5318:Smg1 UTSW 7 117,759,427 (GRCm39) utr 3 prime probably benign
R5356:Smg1 UTSW 7 117,794,356 (GRCm39) utr 3 prime probably benign
R5404:Smg1 UTSW 7 117,806,131 (GRCm39) missense probably damaging 1.00
R5423:Smg1 UTSW 7 117,745,294 (GRCm39) missense possibly damaging 0.70
R5490:Smg1 UTSW 7 117,738,659 (GRCm39) missense possibly damaging 0.86
R5541:Smg1 UTSW 7 117,756,386 (GRCm39) utr 3 prime probably benign
R5564:Smg1 UTSW 7 117,789,042 (GRCm39) utr 3 prime probably benign
R5580:Smg1 UTSW 7 117,748,125 (GRCm39) utr 3 prime probably benign
R5600:Smg1 UTSW 7 117,767,107 (GRCm39) utr 3 prime probably benign
R5628:Smg1 UTSW 7 117,753,924 (GRCm39) utr 3 prime probably benign
R5646:Smg1 UTSW 7 117,811,782 (GRCm39) missense probably benign 0.42
R5656:Smg1 UTSW 7 117,753,887 (GRCm39) utr 3 prime probably benign
R5660:Smg1 UTSW 7 117,742,570 (GRCm39) missense probably benign 0.33
R5706:Smg1 UTSW 7 117,744,813 (GRCm39) missense possibly damaging 0.86
R5786:Smg1 UTSW 7 117,812,120 (GRCm39) missense probably benign 0.12
R5890:Smg1 UTSW 7 117,789,809 (GRCm39) utr 3 prime probably benign
R5912:Smg1 UTSW 7 117,753,809 (GRCm39) utr 3 prime probably benign
R5977:Smg1 UTSW 7 117,740,580 (GRCm39) utr 3 prime probably benign
R5993:Smg1 UTSW 7 117,739,732 (GRCm39) missense probably benign 0.33
R6161:Smg1 UTSW 7 117,762,553 (GRCm39) utr 3 prime probably benign
R6187:Smg1 UTSW 7 117,788,386 (GRCm39) utr 3 prime probably benign
R6264:Smg1 UTSW 7 117,765,310 (GRCm39) utr 3 prime probably benign
R6331:Smg1 UTSW 7 117,753,500 (GRCm39) utr 3 prime probably benign
R6561:Smg1 UTSW 7 117,765,300 (GRCm39) utr 3 prime probably benign
R6571:Smg1 UTSW 7 117,783,737 (GRCm39) utr 3 prime probably benign
R6736:Smg1 UTSW 7 117,756,389 (GRCm39) utr 3 prime probably benign
R6752:Smg1 UTSW 7 117,762,539 (GRCm39) utr 3 prime probably benign
R6777:Smg1 UTSW 7 117,788,340 (GRCm39) utr 3 prime probably benign
R6788:Smg1 UTSW 7 117,783,794 (GRCm39) utr 3 prime probably benign
R6883:Smg1 UTSW 7 117,767,403 (GRCm39) utr 3 prime probably benign
R6991:Smg1 UTSW 7 117,767,091 (GRCm39) utr 3 prime probably benign
R7056:Smg1 UTSW 7 117,745,623 (GRCm39) splice site probably benign
R7058:Smg1 UTSW 7 117,797,502 (GRCm39) utr 3 prime probably benign
R7100:Smg1 UTSW 7 117,783,743 (GRCm39) missense unknown
R7133:Smg1 UTSW 7 117,752,131 (GRCm39) missense unknown
R7221:Smg1 UTSW 7 117,782,020 (GRCm39) missense possibly damaging 0.86
R7229:Smg1 UTSW 7 117,776,178 (GRCm39) missense probably benign 0.03
R7293:Smg1 UTSW 7 117,765,322 (GRCm39) missense unknown
R7361:Smg1 UTSW 7 117,784,200 (GRCm39) missense unknown
R7438:Smg1 UTSW 7 117,795,116 (GRCm39) missense unknown
R7686:Smg1 UTSW 7 117,767,081 (GRCm39) missense unknown
R7798:Smg1 UTSW 7 117,771,162 (GRCm39) missense possibly damaging 0.73
R7908:Smg1 UTSW 7 117,785,357 (GRCm39) missense unknown
R7923:Smg1 UTSW 7 117,742,545 (GRCm39) missense possibly damaging 0.96
R7978:Smg1 UTSW 7 117,792,878 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,365 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,364 (GRCm39) missense unknown
R8025:Smg1 UTSW 7 117,806,212 (GRCm39) nonsense probably null
R8056:Smg1 UTSW 7 117,759,589 (GRCm39) missense unknown
R8061:Smg1 UTSW 7 117,751,610 (GRCm39) missense unknown
R8095:Smg1 UTSW 7 117,772,285 (GRCm39) missense unknown
R8198:Smg1 UTSW 7 117,744,829 (GRCm39) missense probably benign 0.03
R8399:Smg1 UTSW 7 117,789,794 (GRCm39) missense unknown
R8445:Smg1 UTSW 7 117,736,200 (GRCm39) missense possibly damaging 0.72
R8519:Smg1 UTSW 7 117,770,982 (GRCm39) utr 3 prime probably benign
R8817:Smg1 UTSW 7 117,758,887 (GRCm39) missense unknown
R8832:Smg1 UTSW 7 117,739,006 (GRCm39) missense probably benign 0.33
R8855:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8866:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8946:Smg1 UTSW 7 117,751,900 (GRCm39) missense probably null
R8954:Smg1 UTSW 7 117,806,215 (GRCm39) missense probably damaging 1.00
R8967:Smg1 UTSW 7 117,765,739 (GRCm39) missense unknown
R9072:Smg1 UTSW 7 117,783,032 (GRCm39) missense unknown
R9090:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9156:Smg1 UTSW 7 117,753,884 (GRCm39) missense unknown
R9198:Smg1 UTSW 7 117,795,179 (GRCm39) missense unknown
R9240:Smg1 UTSW 7 117,739,031 (GRCm39) missense probably benign 0.18
R9271:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9289:Smg1 UTSW 7 117,744,639 (GRCm39) missense possibly damaging 0.53
R9378:Smg1 UTSW 7 117,777,998 (GRCm39) nonsense probably null
R9396:Smg1 UTSW 7 117,807,303 (GRCm39) missense unknown
R9469:Smg1 UTSW 7 117,739,774 (GRCm39) missense possibly damaging 0.72
R9539:Smg1 UTSW 7 117,744,976 (GRCm39) missense probably benign 0.03
R9549:Smg1 UTSW 7 117,795,254 (GRCm39) missense unknown
R9563:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9564:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9597:Smg1 UTSW 7 117,812,270 (GRCm39) missense unknown
R9643:Smg1 UTSW 7 117,755,933 (GRCm39) missense unknown
R9703:Smg1 UTSW 7 117,739,744 (GRCm39) missense possibly damaging 0.73
R9730:Smg1 UTSW 7 117,783,004 (GRCm39) missense unknown
Z1088:Smg1 UTSW 7 117,777,622 (GRCm39) missense possibly damaging 0.96
Z1088:Smg1 UTSW 7 117,767,884 (GRCm39) nonsense probably null
Z1088:Smg1 UTSW 7 117,753,858 (GRCm39) utr 3 prime probably benign
Z1176:Smg1 UTSW 7 117,806,130 (GRCm39) missense unknown
Z1176:Smg1 UTSW 7 117,806,110 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,812,256 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,767,831 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- TCAGTCATGACAGTACTTCGTATG -3'
(R):5'- TAAGGTCTCCAGATCCCTTGC -3'

Sequencing Primer
(F):5'- GACATAGTCTACTAACCAGCA -3'
(R):5'- AGTTTCCCCTTTTTAAAGAATTGCC -3'
Posted On 2016-09-01