Incidental Mutation 'R5441:Olfr522'
ID427180
Institutional Source Beutler Lab
Gene Symbol Olfr522
Ensembl Gene ENSMUSG00000051180
Gene Nameolfactory receptor 522
SynonymsMOR103-5, GA_x6K02T2PBJ9-42315125-42314187
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140159999-140164764 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140162651 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 100 (T100A)
Ref Sequence ENSEMBL: ENSMUSP00000057288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050585]
Predicted Effect probably benign
Transcript: ENSMUST00000050585
AA Change: T100A

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057288
Gene: ENSMUSG00000051180
AA Change: T100A

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.7e-54 PFAM
Pfam:7tm_1 42 291 1.2e-21 PFAM
Meta Mutation Damage Score 0.1308 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Zic4 C A 9: 91,384,200 P299Q probably damaging Het
Other mutations in Olfr522
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Olfr522 APN 7 140162928 missense probably benign 0.01
IGL02121:Olfr522 APN 7 140162694 missense probably benign 0.10
IGL02399:Olfr522 APN 7 140162600 missense probably benign
IGL02803:Olfr522 APN 7 140162374 missense possibly damaging 0.92
R0446:Olfr522 UTSW 7 140162471 missense probably damaging 1.00
R0538:Olfr522 UTSW 7 140162231 missense probably damaging 1.00
R0707:Olfr522 UTSW 7 140162089 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1584:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1893:Olfr522 UTSW 7 140162821 missense probably damaging 1.00
R1895:Olfr522 UTSW 7 140162813 missense possibly damaging 0.82
R2004:Olfr522 UTSW 7 140162816 missense probably damaging 0.98
R2060:Olfr522 UTSW 7 140162824 missense probably damaging 1.00
R2067:Olfr522 UTSW 7 140162909 missense possibly damaging 0.69
R4841:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4842:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4956:Olfr522 UTSW 7 140162080 missense possibly damaging 0.70
R5189:Olfr522 UTSW 7 140162719 missense probably damaging 0.98
R5325:Olfr522 UTSW 7 140162113 missense probably damaging 1.00
R5618:Olfr522 UTSW 7 140162272 missense probably damaging 1.00
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6609:Olfr522 UTSW 7 140162563 missense probably benign
R7154:Olfr522 UTSW 7 140162084 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTTCAATGGCAGTGGTG -3'
(R):5'- AGAACCTGGTCATTGTGGGC -3'

Sequencing Primer
(F):5'- ATTGGGGCCACAGAACCTG -3'
(R):5'- CACCATCAGTGCTAGCCG -3'
Posted On2016-09-01