Incidental Mutation 'R5441:Zic4'
ID427187
Institutional Source Beutler Lab
Gene Symbol Zic4
Ensembl Gene ENSMUSG00000036972
Gene Namezinc finger protein of the cerebellum 4
Synonyms
MMRRC Submission 043006-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5441 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location91362413-91389348 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 91384200 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 299 (P299Q)
Ref Sequence ENSEMBL: ENSMUSP00000069568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066384] [ENSMUST00000172646] [ENSMUST00000173054] [ENSMUST00000173933]
Predicted Effect probably damaging
Transcript: ENSMUST00000066384
AA Change: P299Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069568
Gene: ENSMUSG00000036972
AA Change: P299Q

DomainStartEndE-ValueType
ZnF_C2H2 135 169 4.74e1 SMART
ZnF_C2H2 178 205 7.68e0 SMART
ZnF_C2H2 211 235 8.02e-5 SMART
ZnF_C2H2 241 265 7.15e-2 SMART
ZnF_C2H2 271 295 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000085242
SMART Domains Protein: ENSMUSP00000082339
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 24 48 7.15e-2 SMART
ZnF_C2H2 54 78 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170572
Predicted Effect probably damaging
Transcript: ENSMUST00000172646
AA Change: P292Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134053
Gene: ENSMUSG00000036972
AA Change: P292Q

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172858
SMART Domains Protein: ENSMUSP00000133795
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
ZnF_C2H2 135 169 4.74e1 SMART
ZnF_C2H2 178 205 7.68e0 SMART
ZnF_C2H2 211 235 8.02e-5 SMART
ZnF_C2H2 241 265 7.15e-2 SMART
ZnF_C2H2 271 295 3.21e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173054
SMART Domains Protein: ENSMUSP00000134364
Gene: ENSMUSG00000036972

DomainStartEndE-ValueType
PDB:2EJ4|A 122 181 3e-16 PDB
Blast:ZnF_C2H2 128 151 5e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000173933
AA Change: P292Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133958
Gene: ENSMUSG00000036972
AA Change: P292Q

DomainStartEndE-ValueType
ZnF_C2H2 128 162 4.74e1 SMART
ZnF_C2H2 171 198 7.68e0 SMART
ZnF_C2H2 204 228 8.02e-5 SMART
ZnF_C2H2 234 258 7.15e-2 SMART
ZnF_C2H2 264 288 3.21e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195215
Meta Mutation Damage Score 0.0264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. Members of this family are important during development, and have been associated with X-linked visceral heterotaxy and holoprosencephaly type 5. This gene is closely linked to the gene encoding zinc finger protein of the cerebellum 1, a related family member on chromosome 3. Heterozygous deletion of these linked genes is involved in Dandy-Walker malformation, which is a congenital cerebellar malformation. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice heterozygous for a knock-out allele exhibit posterior cerebellar hypoplasia and a mild defect in anterior cerebellar foliation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,156,914 T2042M probably damaging Het
Abca12 A G 1: 71,295,056 Y1096H probably damaging Het
Aspa A T 11: 73,305,594 F261I probably damaging Het
Atm C A 9: 53,516,467 G448* probably null Het
Atmin T A 8: 116,957,957 D785E probably damaging Het
C87414 A T 5: 93,636,597 M139K possibly damaging Het
Car1 G C 3: 14,776,304 R90G probably damaging Het
Cdh11 T C 8: 102,647,546 D520G probably benign Het
Cers5 T A 15: 99,751,238 K50* probably null Het
Chad A T 11: 94,568,292 D340V probably benign Het
Cspg5 T C 9: 110,246,643 I68T probably benign Het
Fcrla T A 1: 170,925,422 probably benign Het
Fer1l4 T A 2: 156,023,257 D1608V probably benign Het
Fzd5 T A 1: 64,735,417 Q395L probably benign Het
Gm7664 T A 13: 62,528,650 probably benign Het
Hk3 T C 13: 55,015,056 E2G probably damaging Het
Hmcn2 G A 2: 31,406,416 E2677K possibly damaging Het
Hydin T C 8: 110,565,109 L3411P possibly damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Lysmd2 C T 9: 75,625,972 H70Y possibly damaging Het
Msi2 A G 11: 88,479,992 probably benign Het
Msi2 G A 11: 88,718,095 probably benign Het
Napsa T A 7: 44,581,393 probably benign Het
Nlrp4a T A 7: 26,454,153 L710M probably damaging Het
Olfr1025-ps1 T A 2: 85,918,590 F222I probably benign Het
Olfr103 T C 17: 37,336,268 probably null Het
Olfr1510 T A 14: 52,409,957 K305M probably benign Het
Olfr459 C T 6: 41,771,848 M150I probably benign Het
Olfr522 T C 7: 140,162,651 T100A probably benign Het
Plbd2 T A 5: 120,499,082 Y105F probably benign Het
Plppr5 A T 3: 117,662,471 I214F possibly damaging Het
Ptcd3 A G 6: 71,881,521 V655A possibly damaging Het
Ptpn14 T C 1: 189,798,570 L78P probably damaging Het
Ralgapa1 A C 12: 55,719,623 D1295E probably damaging Het
Rnf213 G A 11: 119,409,020 D192N probably damaging Het
Ropn1 A G 16: 34,666,797 I34M probably damaging Het
Rpe65 G T 3: 159,604,401 G104C probably damaging Het
Scgb2b27 T C 7: 34,013,157 probably benign Het
Sh3bgr T C 16: 96,205,917 I29T possibly damaging Het
Smg1 T C 7: 118,195,081 probably benign Het
Stim2 T A 5: 54,075,370 C68* probably null Het
Syne2 G A 12: 75,989,143 V3736I possibly damaging Het
Tbx19 T C 1: 165,153,680 N82D probably damaging Het
Tdp1 T A 12: 99,910,285 V353D probably damaging Het
Tg T A 15: 66,696,520 I1352K possibly damaging Het
Thsd4 T C 9: 59,979,783 T919A probably damaging Het
Tmprss11f A T 5: 86,528,203 M373K probably damaging Het
Tmprss15 T A 16: 79,071,447 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Ube2o G A 11: 116,544,442 R507C probably damaging Het
Unc93b1 T C 19: 3,943,703 F382L probably benign Het
Vav2 A T 2: 27,270,110 probably benign Het
Vmn1r207-ps T C 13: 22,726,516 noncoding transcript Het
Zan T A 5: 137,436,751 I2127F unknown Het
Zfp748 C A 13: 67,540,618 C841F probably damaging Het
Other mutations in Zic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Zic4 APN 9 91384175 missense probably damaging 1.00
PIT4418001:Zic4 UTSW 9 91379394 missense possibly damaging 0.91
R0628:Zic4 UTSW 9 91384117 nonsense probably null
R0628:Zic4 UTSW 9 91384119 missense probably benign 0.09
R1747:Zic4 UTSW 9 91384146 missense probably damaging 1.00
R2242:Zic4 UTSW 9 91378653 intron probably benign
R3917:Zic4 UTSW 9 91384341 splice site probably benign
R4021:Zic4 UTSW 9 91379036 missense probably benign 0.00
R4457:Zic4 UTSW 9 91379262 missense probably damaging 0.97
R4722:Zic4 UTSW 9 91379204 missense probably damaging 1.00
R5135:Zic4 UTSW 9 91384152 missense probably damaging 1.00
R5629:Zic4 UTSW 9 91378752 missense probably benign 0.36
R7179:Zic4 UTSW 9 91379121 missense possibly damaging 0.89
R7238:Zic4 UTSW 9 91379397 missense probably benign 0.38
X0018:Zic4 UTSW 9 91378803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCTTTCAGATGTGAGTTCGAGG -3'
(R):5'- AAGCAGCAGCCCTGATACTG -3'

Sequencing Primer
(F):5'- TCGAGGGCTGTGAGAGGC -3'
(R):5'- AGCCCTGATACTGGAGGC -3'
Posted On2016-09-01