Incidental Mutation 'R5442:Ttll11'
ID427210
Institutional Source Beutler Lab
Gene Symbol Ttll11
Ensembl Gene ENSMUSG00000026885
Gene Nametubulin tyrosine ligase-like family, member 11
Synonyms4932702F08Rik, 4933424A20Rik, D2Ertd624e
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35751241-35979913 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 35903123 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tryptophan at position 191 (*191W)
Ref Sequence ENSEMBL: ENSMUSP00000125627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028248] [ENSMUST00000112976] [ENSMUST00000140201] [ENSMUST00000161970] [ENSMUST00000162172]
Predicted Effect probably benign
Transcript: ENSMUST00000028248
AA Change: D236G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028248
Gene: ENSMUSG00000026885
AA Change: D236G

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 9.1e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112976
AA Change: D236G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108600
Gene: ENSMUSG00000026885
AA Change: D236G

DomainStartEndE-ValueType
low complexity region 11 37 N/A INTRINSIC
low complexity region 79 101 N/A INTRINSIC
low complexity region 107 122 N/A INTRINSIC
Pfam:TTL 170 477 5.9e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127742
Predicted Effect probably benign
Transcript: ENSMUST00000140201
AA Change: D52G

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124510
Gene: ENSMUSG00000026885
AA Change: D52G

DomainStartEndE-ValueType
Pfam:TTL 1 210 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160284
Predicted Effect probably benign
Transcript: ENSMUST00000160906
AA Change: D52G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125511
Gene: ENSMUSG00000026885
AA Change: D52G

DomainStartEndE-ValueType
Pfam:TTL 1 304 4.2e-65 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161970
AA Change: *191W
SMART Domains Protein: ENSMUSP00000125627
Gene: ENSMUSG00000026885
AA Change: *191W

DomainStartEndE-ValueType
SCOP:d1gosa1 33 88 5e-3 SMART
low complexity region 107 122 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162172
AA Change: D52G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125199
Gene: ENSMUSG00000026885
AA Change: D52G

DomainStartEndE-ValueType
Pfam:TTL 1 204 1.2e-48 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Ttll11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Ttll11 APN 2 35902720 nonsense probably null
IGL01148:Ttll11 APN 2 35784193 missense probably damaging 0.96
IGL02933:Ttll11 APN 2 35979410 missense probably benign
e-suppressor UTSW 2 35752406 missense probably damaging 1.00
R0356:Ttll11 UTSW 2 35902676 missense possibly damaging 0.66
R0494:Ttll11 UTSW 2 35944874 missense probably damaging 1.00
R1494:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1630:Ttll11 UTSW 2 35889325 missense probably damaging 0.96
R1688:Ttll11 UTSW 2 35795379 missense probably damaging 1.00
R1939:Ttll11 UTSW 2 35940753 missense probably null
R2414:Ttll11 UTSW 2 35979534 missense unknown
R2986:Ttll11 UTSW 2 35817738 missense probably benign 0.00
R4295:Ttll11 UTSW 2 35979552 small deletion probably benign
R4346:Ttll11 UTSW 2 35784118 missense probably benign 0.22
R5234:Ttll11 UTSW 2 35940733 missense probably damaging 1.00
R5340:Ttll11 UTSW 2 35902789 missense probably damaging 0.99
R5482:Ttll11 UTSW 2 35752406 missense probably damaging 1.00
R5604:Ttll11 UTSW 2 35817786 missense probably benign 0.07
R6219:Ttll11 UTSW 2 35752499 splice site probably null
R6481:Ttll11 UTSW 2 35902754 missense probably damaging 1.00
R6764:Ttll11 UTSW 2 35890448 splice site probably null
R6944:Ttll11 UTSW 2 35752294 missense probably benign 0.05
R7224:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R7511:Ttll11 UTSW 2 35903034 missense probably damaging 1.00
R8030:Ttll11 UTSW 2 35902673 missense probably damaging 1.00
R8052:Ttll11 UTSW 2 35979515 missense unknown
R8200:Ttll11 UTSW 2 35944928 missense probably damaging 1.00
R8332:Ttll11 UTSW 2 35940709 missense possibly damaging 0.85
R8691:Ttll11 UTSW 2 35784149 missense probably damaging 1.00
R8801:Ttll11 UTSW 2 35902973 missense probably damaging 1.00
X0026:Ttll11 UTSW 2 35795352 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACGGATGTCGAACTTGAGTTTG -3'
(R):5'- GCCTGGCATGTCACAGGTAATC -3'

Sequencing Primer
(F):5'- CGAACTTGAGTTTGTCGATGAG -3'
(R):5'- ACTGGTGAAGTGACTTGAACTC -3'
Posted On2016-09-01