Mutagenetix > Incidental Mutation

Incidental Mutation 'R5442:Lpin3'

427214

Institutional Source

Beutler Lab

Gene Symbol

Lpin3

Ensembl Gene

ENSMUSG00000027412

Gene Name

lipin 3

Synonyms

9130206L11Rik

MMRRC Submission

043007-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5442 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160880670-160906002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 160905016 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 781 (Y781C)

Ref Sequence

ENSEMBL: ENSMUSP00000105083 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]

AlphaFold

Q99PI4

Predicted Effect

probably damaging
Transcript: ENSMUST00000040872
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: Y771C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057169

SMART Domains

Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:EMI	55	125	7.3e-18	PFAM
low complexity region	144	161	N/A	INTRINSIC
low complexity region	281	295	N/A	INTRINSIC
low complexity region	359	381	N/A	INTRINSIC
low complexity region	451	460	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109454

SMART Domains

Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:EMI	54	127	6.4e-22	PFAM
low complexity region	144	161	N/A	INTRINSIC
low complexity region	234	248	N/A	INTRINSIC
low complexity region	312	334	N/A	INTRINSIC
low complexity region	404	413	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109455
AA Change: Y740C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: Y740C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	2.4e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	528	538	N/A	INTRINSIC
LNS2	606	762	1.4e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109456
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: Y771C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	114	5.8e-52	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
low complexity region	559	569	N/A	INTRINSIC
LNS2	637	793	1.4e-105	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109457
AA Change: Y781C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: Y781C

Domain	Start	End	E-Value	Type
Pfam:Lipin_N	1	110	4.1e-48	PFAM
low complexity region	136	148	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	176	191	N/A	INTRINSIC
low complexity region	220	233	N/A	INTRINSIC
low complexity region	271	282	N/A	INTRINSIC
Pfam:Lipin_mid	435	538	9.5e-35	PFAM
low complexity region	569	579	N/A	INTRINSIC
LNS2	647	803	1.4e-105	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124920

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,018,768	M114T	probably benign	Het
Ablim3	A	T	18: 61,857,225		probably null	Het
Adcy10	A	G	1: 165,513,140	D238G	probably benign	Het
Astn2	G	T	4: 65,581,786	S955R	possibly damaging	Het
Casc3	A	G	11: 98,821,471	E112G	probably damaging	Het
Cetn4	C	T	3: 37,309,945	V39I	probably benign	Het
Commd4	A	G	9: 57,156,806	V37A	possibly damaging	Het
Dyrk2	T	C	10: 118,860,738	Q205R	possibly damaging	Het
Gal3st4	A	G	5: 138,265,780	V319A	possibly damaging	Het
Gm14085	A	G	2: 122,486,869	N36S	probably benign	Het
Inpp5d	G	A	1: 87,718,066	A1058T	probably benign	Het
Lrat	C	T	3: 82,903,220	V165M	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Nlrp6	T	C	7: 140,922,190	S142P	probably benign	Het
Oas1a	T	C	5: 120,897,206	T349A	probably benign	Het
Olfr1033	T	C	2: 86,041,951	V212A	probably benign	Het
Olfr110	A	T	17: 37,499,439	I263F	probably damaging	Het
Olfr671	A	T	7: 104,975,228	F252L	possibly damaging	Het
Olfr898	T	A	9: 38,349,862	S260T	probably benign	Het
Pakap	C	A	4: 57,637,876	P18Q	probably null	Het
Pcdha2	T	C	18: 36,939,862	V182A	probably benign	Het
Phactr3	A	G	2: 178,142,461	D26G	probably benign	Het
Phrf1	G	A	7: 141,240,937	R159H	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rab3ip	T	C	10: 116,918,848	T268A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rem1	A	G	2: 152,628,057		probably null	Het
Syne1	A	G	10: 5,343,473	M1286T	probably benign	Het
Thsd7a	T	C	6: 12,748,800	T52A	probably benign	Het
Tmem135	A	T	7: 89,144,664	F390Y	probably damaging	Het
Trio	T	C	15: 27,856,194	D696G	probably benign	Het
Ttll11	T	C	2: 35,903,123	*191W	probably null	Het
Ubr4	A	G	4: 139,407,772	D805G	probably damaging	Het
Usp9y	A	G	Y: 1,336,467	I1469T	possibly damaging	Het
Vmn1r70	G	T	7: 10,633,950	A122S	possibly damaging	Het
Vmn2r78	G	T	7: 86,920,122	L74F	possibly damaging	Het
Wdfy3	T	C	5: 101,896,559	E1860G	probably benign	Het

Other mutations in Lpin3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Lpin3	APN	2	160893998	missense	probably damaging	1.00
IGL01373:Lpin3	APN	2	160903729	missense	probably damaging	1.00
IGL01576:Lpin3	APN	2	160897127	missense	probably benign	0.02
IGL02124:Lpin3	APN	2	160895833	critical splice donor site	probably null
IGL02272:Lpin3	APN	2	160901661	missense	probably benign	0.15
IGL02314:Lpin3	APN	2	160898718	nonsense	probably null
IGL02374:Lpin3	APN	2	160895838	splice site	probably benign
IGL02554:Lpin3	APN	2	160896787	missense	probably damaging	1.00
IGL02693:Lpin3	APN	2	160905055	missense	probably damaging	1.00
IGL02858:Lpin3	APN	2	160898620	splice site	probably benign
IGL03143:Lpin3	APN	2	160903598	splice site	probably benign
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0100:Lpin3	UTSW	2	160905340	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0211:Lpin3	UTSW	2	160898681	missense	probably damaging	1.00
R0329:Lpin3	UTSW	2	160905305	missense	probably benign
R0330:Lpin3	UTSW	2	160905305	missense	probably benign
R0570:Lpin3	UTSW	2	160904024	splice site	probably benign
R0633:Lpin3	UTSW	2	160903974	missense	probably damaging	0.99
R0781:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1109:Lpin3	UTSW	2	160899021	missense	probably damaging	1.00
R1110:Lpin3	UTSW	2	160894079	missense	probably benign	0.03
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1404:Lpin3	UTSW	2	160892390	critical splice donor site	probably null
R1513:Lpin3	UTSW	2	160904548	missense	probably damaging	1.00
R1543:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R1785:Lpin3	UTSW	2	160896809	nonsense	probably null
R1786:Lpin3	UTSW	2	160896809	nonsense	probably null
R1896:Lpin3	UTSW	2	160905298	missense	probably damaging	1.00
R4440:Lpin3	UTSW	2	160898645	missense	probably benign
R4470:Lpin3	UTSW	2	160895434	missense	probably benign	0.00
R4996:Lpin3	UTSW	2	160905287	missense	probably damaging	1.00
R5014:Lpin3	UTSW	2	160904828	missense	probably damaging	1.00
R5124:Lpin3	UTSW	2	160897061	missense	probably benign
R5184:Lpin3	UTSW	2	160897138	missense	probably benign
R5405:Lpin3	UTSW	2	160903929	missense	probably damaging	1.00
R5666:Lpin3	UTSW	2	160897330	missense	probably benign
R5670:Lpin3	UTSW	2	160897330	missense	probably benign
R5693:Lpin3	UTSW	2	160895400	missense	probably benign	0.00
R6084:Lpin3	UTSW	2	160895801	missense	probably benign	0.38
R6994:Lpin3	UTSW	2	160904883	missense	probably damaging	1.00
R7090:Lpin3	UTSW	2	160896752	missense	probably damaging	0.96
R7157:Lpin3	UTSW	2	160898707	missense	probably benign	0.02
R7207:Lpin3	UTSW	2	160894003	nonsense	probably null
R7430:Lpin3	UTSW	2	160898666	missense	probably benign	0.06
R7459:Lpin3	UTSW	2	160897300	missense	probably benign	0.06
R7603:Lpin3	UTSW	2	160903754	splice site	probably null
R7644:Lpin3	UTSW	2	160896770	missense	probably benign	0.02
R7706:Lpin3	UTSW	2	160905290	missense	probably damaging	1.00
R7803:Lpin3	UTSW	2	160895390	missense	possibly damaging	0.69
R8443:Lpin3	UTSW	2	160895353	missense	probably damaging	1.00
R8985:Lpin3	UTSW	2	160896754	missense	probably benign	0.00
R9288:Lpin3	UTSW	2	160903632	missense	probably damaging	1.00
R9385:Lpin3	UTSW	2	160897073	missense	probably benign
R9455:Lpin3	UTSW	2	160895339	missense	probably benign	0.02
R9482:Lpin3	UTSW	2	160904496	missense	probably damaging	1.00
R9700:Lpin3	UTSW	2	160898645	missense	probably benign	0.11
R9732:Lpin3	UTSW	2	160892276	missense	probably damaging	1.00
X0002:Lpin3	UTSW	2	160903717	missense	probably damaging	1.00
Z1088:Lpin3	UTSW	2	160892231	missense	probably damaging	0.99
Z1176:Lpin3	UTSW	2	160899785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTGCCTGAGTGATATCC -3'
(R):5'- TGAGTCAGAGTTGTCACGAGG -3'

Sequencing Primer
(F):5'- TGCCTGAGTGATATCCAGCAG -3'
(R):5'- TCAGAGTTGTCACGAGGCAGTG -3'

Posted On

2016-09-01