Incidental Mutation 'R5442:Lpin3'
ID427214
Institutional Source Beutler Lab
Gene Symbol Lpin3
Ensembl Gene ENSMUSG00000027412
Gene Namelipin 3
Synonyms9130206L11Rik
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location160880670-160906002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160905016 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 781 (Y781C)
Ref Sequence ENSEMBL: ENSMUSP00000105083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably damaging
Transcript: ENSMUST00000040872
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412
AA Change: Y771C

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057169
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109454
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109455
AA Change: Y740C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412
AA Change: Y740C

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109456
AA Change: Y771C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412
AA Change: Y771C

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109457
AA Change: Y781C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412
AA Change: Y781C

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124920
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the lipin family of proteins, and all family members share strong homology in their C-terminal region. This protein is thought to form hetero-oligomers with other lipin family members, while one family member, lipin 1, can also form homo-oligomers. This protein contains conserved motifs for phosphatidate phosphatase 1 (PAP1) activity as well as a domain that interacts with a transcriptional co-activator. Lipin complexes act in the cytoplasm to catalyze the dephosphorylation of phosphatidic acid to produce diacylglycerol, which is the precursor of both triglycerides and phospholipids. Lipin complexes are also thought to regulate gene expression as transcriptional co-activators in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Lpin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Lpin3 APN 2 160893998 missense probably damaging 1.00
IGL01373:Lpin3 APN 2 160903729 missense probably damaging 1.00
IGL01576:Lpin3 APN 2 160897127 missense probably benign 0.02
IGL02124:Lpin3 APN 2 160895833 critical splice donor site probably null
IGL02272:Lpin3 APN 2 160901661 missense probably benign 0.15
IGL02314:Lpin3 APN 2 160898718 nonsense probably null
IGL02374:Lpin3 APN 2 160895838 splice site probably benign
IGL02554:Lpin3 APN 2 160896787 missense probably damaging 1.00
IGL02693:Lpin3 APN 2 160905055 missense probably damaging 1.00
IGL02858:Lpin3 APN 2 160898620 splice site probably benign
IGL03143:Lpin3 APN 2 160903598 splice site probably benign
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0100:Lpin3 UTSW 2 160905340 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0211:Lpin3 UTSW 2 160898681 missense probably damaging 1.00
R0329:Lpin3 UTSW 2 160905305 missense probably benign
R0330:Lpin3 UTSW 2 160905305 missense probably benign
R0570:Lpin3 UTSW 2 160904024 splice site probably benign
R0633:Lpin3 UTSW 2 160903974 missense probably damaging 0.99
R0781:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1109:Lpin3 UTSW 2 160899021 missense probably damaging 1.00
R1110:Lpin3 UTSW 2 160894079 missense probably benign 0.03
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1404:Lpin3 UTSW 2 160892390 critical splice donor site probably null
R1513:Lpin3 UTSW 2 160904548 missense probably damaging 1.00
R1543:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R1785:Lpin3 UTSW 2 160896809 nonsense probably null
R1786:Lpin3 UTSW 2 160896809 nonsense probably null
R1896:Lpin3 UTSW 2 160905298 missense probably damaging 1.00
R4440:Lpin3 UTSW 2 160898645 missense probably benign
R4470:Lpin3 UTSW 2 160895434 missense probably benign 0.00
R4996:Lpin3 UTSW 2 160905287 missense probably damaging 1.00
R5014:Lpin3 UTSW 2 160904828 missense probably damaging 1.00
R5124:Lpin3 UTSW 2 160897061 missense probably benign
R5184:Lpin3 UTSW 2 160897138 missense probably benign
R5405:Lpin3 UTSW 2 160903929 missense probably damaging 1.00
R5666:Lpin3 UTSW 2 160897330 missense probably benign
R5670:Lpin3 UTSW 2 160897330 missense probably benign
R5693:Lpin3 UTSW 2 160895400 missense probably benign 0.00
R6084:Lpin3 UTSW 2 160895801 missense probably benign 0.38
R6994:Lpin3 UTSW 2 160904883 missense probably damaging 1.00
R7090:Lpin3 UTSW 2 160896752 missense probably damaging 0.96
R7157:Lpin3 UTSW 2 160898707 missense probably benign 0.02
R7207:Lpin3 UTSW 2 160894003 nonsense probably null
R7430:Lpin3 UTSW 2 160898666 missense probably benign 0.06
R7459:Lpin3 UTSW 2 160897300 missense probably benign 0.06
R7603:Lpin3 UTSW 2 160903754 splice site probably null
R7644:Lpin3 UTSW 2 160896770 missense probably benign 0.02
R7706:Lpin3 UTSW 2 160905290 missense probably damaging 1.00
R7803:Lpin3 UTSW 2 160895390 missense possibly damaging 0.69
R8443:Lpin3 UTSW 2 160895353 missense probably damaging 1.00
X0002:Lpin3 UTSW 2 160903717 missense probably damaging 1.00
Z1088:Lpin3 UTSW 2 160892231 missense probably damaging 0.99
Z1176:Lpin3 UTSW 2 160899785 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTGCCTGAGTGATATCC -3'
(R):5'- TGAGTCAGAGTTGTCACGAGG -3'

Sequencing Primer
(F):5'- TGCCTGAGTGATATCCAGCAG -3'
(R):5'- TCAGAGTTGTCACGAGGCAGTG -3'
Posted On2016-09-01