Mutagenetix > Incidental Mutation

Incidental Mutation 'R5442:Phactr3'

427215

Institutional Source

Beutler Lab

Gene Symbol

Phactr3

Ensembl Gene

ENSMUSG00000027525

Gene Name

phosphatase and actin regulator 3

Synonyms

4930415A02Rik, 1500003N10Rik, scapinin

MMRRC Submission

043007-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R5442 (G1)

Quality Score

102

Status

Not validated

Chromosome

Chromosomal Location

178118975-178338492 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 178142461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 26 (D26G)

Ref Sequence

ENSEMBL: ENSMUSP00000099355 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103066] [ENSMUST00000108916] [ENSMUST00000108917]

AlphaFold

Q8BYK5

Predicted Effect

probably benign
Transcript: ENSMUST00000103066
AA Change: D26G

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525
AA Change: D26G

Domain	Start	End	E-Value	Type
low complexity region	17	33	N/A	INTRINSIC
low complexity region	75	88	N/A	INTRINSIC
RPEL	92	117	2.08e0	SMART
low complexity region	227	246	N/A	INTRINSIC
RPEL	400	425	5.1e-4	SMART
low complexity region	427	437	N/A	INTRINSIC
RPEL	438	463	3.24e-6	SMART
RPEL	476	501	9.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108916

SMART Domains

Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525

Domain	Start	End	E-Value	Type
low complexity region	71	84	N/A	INTRINSIC
RPEL	88	113	2.08e0	SMART
low complexity region	223	242	N/A	INTRINSIC
RPEL	396	421	5.1e-4	SMART
low complexity region	423	433	N/A	INTRINSIC
RPEL	434	459	3.24e-6	SMART
RPEL	472	497	9.82e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108917

SMART Domains

Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525

Domain	Start	End	E-Value	Type
low complexity region	71	84	N/A	INTRINSIC
RPEL	88	113	2.08e0	SMART
low complexity region	223	242	N/A	INTRINSIC
RPEL	396	421	5.1e-4	SMART
low complexity region	423	433	N/A	INTRINSIC
RPEL	436	458	2.74e-4	SMART
RPEL	471	496	9.82e-6	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,018,768	M114T	probably benign	Het
Ablim3	A	T	18: 61,857,225		probably null	Het
Adcy10	A	G	1: 165,513,140	D238G	probably benign	Het
Astn2	G	T	4: 65,581,786	S955R	possibly damaging	Het
Casc3	A	G	11: 98,821,471	E112G	probably damaging	Het
Cetn4	C	T	3: 37,309,945	V39I	probably benign	Het
Commd4	A	G	9: 57,156,806	V37A	possibly damaging	Het
Dyrk2	T	C	10: 118,860,738	Q205R	possibly damaging	Het
Gal3st4	A	G	5: 138,265,780	V319A	possibly damaging	Het
Gm14085	A	G	2: 122,486,869	N36S	probably benign	Het
Inpp5d	G	A	1: 87,718,066	A1058T	probably benign	Het
Lpin3	A	G	2: 160,905,016	Y781C	probably damaging	Het
Lrat	C	T	3: 82,903,220	V165M	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Nlrp6	T	C	7: 140,922,190	S142P	probably benign	Het
Oas1a	T	C	5: 120,897,206	T349A	probably benign	Het
Olfr1033	T	C	2: 86,041,951	V212A	probably benign	Het
Olfr110	A	T	17: 37,499,439	I263F	probably damaging	Het
Olfr671	A	T	7: 104,975,228	F252L	possibly damaging	Het
Olfr898	T	A	9: 38,349,862	S260T	probably benign	Het
Pakap	C	A	4: 57,637,876	P18Q	probably null	Het
Pcdha2	T	C	18: 36,939,862	V182A	probably benign	Het
Phrf1	G	A	7: 141,240,937	R159H	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rab3ip	T	C	10: 116,918,848	T268A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rem1	A	G	2: 152,628,057		probably null	Het
Syne1	A	G	10: 5,343,473	M1286T	probably benign	Het
Thsd7a	T	C	6: 12,748,800	T52A	probably benign	Het
Tmem135	A	T	7: 89,144,664	F390Y	probably damaging	Het
Trio	T	C	15: 27,856,194	D696G	probably benign	Het
Ttll11	T	C	2: 35,903,123	*191W	probably null	Het
Ubr4	A	G	4: 139,407,772	D805G	probably damaging	Het
Usp9y	A	G	Y: 1,336,467	I1469T	possibly damaging	Het
Vmn1r70	G	T	7: 10,633,950	A122S	possibly damaging	Het
Vmn2r78	G	T	7: 86,920,122	L74F	possibly damaging	Het
Wdfy3	T	C	5: 101,896,559	E1860G	probably benign	Het

Other mutations in Phactr3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01419:Phactr3	APN	2	178279062	missense	probably benign	0.00
IGL01432:Phactr3	APN	2	178283100	missense	probably benign	0.05
IGL01580:Phactr3	APN	2	178269504	splice site	probably benign
IGL02688:Phactr3	APN	2	178278999	missense	probably damaging	0.96
IGL02985:Phactr3	APN	2	178175457	missense	probably benign
PIT4151001:Phactr3	UTSW	2	178334068	missense	probably damaging	1.00
R1854:Phactr3	UTSW	2	178283147	missense	probably damaging	1.00
R2132:Phactr3	UTSW	2	178283966	missense	probably benign	0.14
R3110:Phactr3	UTSW	2	178279017	missense	possibly damaging	0.85
R3112:Phactr3	UTSW	2	178279017	missense	possibly damaging	0.85
R3122:Phactr3	UTSW	2	178331618	missense	probably damaging	1.00
R4193:Phactr3	UTSW	2	178283152	missense	probably damaging	0.98
R4194:Phactr3	UTSW	2	178283109	missense	possibly damaging	0.80
R4243:Phactr3	UTSW	2	178283189	splice site	probably null
R4245:Phactr3	UTSW	2	178283189	splice site	probably null
R4397:Phactr3	UTSW	2	178175406	intron	probably benign
R4433:Phactr3	UTSW	2	178283132	missense	probably damaging	1.00
R4581:Phactr3	UTSW	2	178283172	missense	probably damaging	1.00
R4772:Phactr3	UTSW	2	178283936	missense	probably damaging	1.00
R4830:Phactr3	UTSW	2	178284018	missense	probably damaging	0.98
R5045:Phactr3	UTSW	2	178331619	missense	probably damaging	1.00
R5461:Phactr3	UTSW	2	178278901	missense	probably benign
R5816:Phactr3	UTSW	2	178302793	missense	probably damaging	1.00
R6276:Phactr3	UTSW	2	178279019	missense	probably damaging	0.99
R6668:Phactr3	UTSW	2	178332864	missense	probably damaging	1.00
R7144:Phactr3	UTSW	2	178302736	missense	probably damaging	1.00
R7340:Phactr3	UTSW	2	178334061	missense	probably damaging	1.00
R7798:Phactr3	UTSW	2	178283910	missense	probably benign	0.19
R8009:Phactr3	UTSW	2	178332944	missense	probably damaging	1.00
R8074:Phactr3	UTSW	2	178302796	missense	probably damaging	1.00
R8348:Phactr3	UTSW	2	178256142	missense	probably benign	0.03
R8530:Phactr3	UTSW	2	178284026	missense	probably damaging	1.00
R9077:Phactr3	UTSW	2	178332965	splice site	probably benign
R9153:Phactr3	UTSW	2	178283946	missense	possibly damaging	0.79
R9406:Phactr3	UTSW	2	178284063	missense	probably damaging	0.99
R9676:Phactr3	UTSW	2	178284044	nonsense	probably null
R9721:Phactr3	UTSW	2	178256250	missense	probably damaging	1.00
R9722:Phactr3	UTSW	2	178256250	missense	probably damaging	1.00
R9776:Phactr3	UTSW	2	178334103	missense	probably damaging	1.00
R9778:Phactr3	UTSW	2	178283012	missense	possibly damaging	0.73
Z1176:Phactr3	UTSW	2	178269374	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTCCCCTGGAATATAAGCAGAAG -3'
(R):5'- ACCTGAATCGGATCGCTGTC -3'

Sequencing Primer
(F):5'- ACCCTGAAGCCAGCCTG -3'
(R):5'- GTCCCCCCCAGTAAAGG -3'

Posted On

2016-09-01