Incidental Mutation 'R5442:Phactr3'
ID427215
Institutional Source Beutler Lab
Gene Symbol Phactr3
Ensembl Gene ENSMUSG00000027525
Gene Namephosphatase and actin regulator 3
Synonyms4930415A02Rik, 1500003N10Rik, scapinin
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R5442 (G1)
Quality Score102
Status Not validated
Chromosome2
Chromosomal Location178118975-178338492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 178142461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 26 (D26G)
Ref Sequence ENSEMBL: ENSMUSP00000099355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103066] [ENSMUST00000108916] [ENSMUST00000108917]
Predicted Effect probably benign
Transcript: ENSMUST00000103066
AA Change: D26G

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099355
Gene: ENSMUSG00000027525
AA Change: D26G

DomainStartEndE-ValueType
low complexity region 17 33 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
RPEL 92 117 2.08e0 SMART
low complexity region 227 246 N/A INTRINSIC
RPEL 400 425 5.1e-4 SMART
low complexity region 427 437 N/A INTRINSIC
RPEL 438 463 3.24e-6 SMART
RPEL 476 501 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108916
SMART Domains Protein: ENSMUSP00000104544
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 434 459 3.24e-6 SMART
RPEL 472 497 9.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108917
SMART Domains Protein: ENSMUSP00000104545
Gene: ENSMUSG00000027525

DomainStartEndE-ValueType
low complexity region 71 84 N/A INTRINSIC
RPEL 88 113 2.08e0 SMART
low complexity region 223 242 N/A INTRINSIC
RPEL 396 421 5.1e-4 SMART
low complexity region 423 433 N/A INTRINSIC
RPEL 436 458 2.74e-4 SMART
RPEL 471 496 9.82e-6 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatase and actin regulator protein family. The encoded protein is associated with the nuclear scaffold in proliferating cells, and binds to actin and the catalytic subunit of protein phosphatase-1, suggesting that it functions as a regulatory subunit of protein phosphatase-1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Phactr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Phactr3 APN 2 178279062 missense probably benign 0.00
IGL01432:Phactr3 APN 2 178283100 missense probably benign 0.05
IGL01580:Phactr3 APN 2 178269504 splice site probably benign
IGL02688:Phactr3 APN 2 178278999 missense probably damaging 0.96
IGL02985:Phactr3 APN 2 178175457 missense probably benign
PIT4151001:Phactr3 UTSW 2 178334068 missense probably damaging 1.00
R1854:Phactr3 UTSW 2 178283147 missense probably damaging 1.00
R2132:Phactr3 UTSW 2 178283966 missense probably benign 0.14
R3110:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3112:Phactr3 UTSW 2 178279017 missense possibly damaging 0.85
R3122:Phactr3 UTSW 2 178331618 missense probably damaging 1.00
R4193:Phactr3 UTSW 2 178283152 missense probably damaging 0.98
R4194:Phactr3 UTSW 2 178283109 missense possibly damaging 0.80
R4243:Phactr3 UTSW 2 178283189 splice site probably null
R4245:Phactr3 UTSW 2 178283189 splice site probably null
R4397:Phactr3 UTSW 2 178175406 intron probably benign
R4433:Phactr3 UTSW 2 178283132 missense probably damaging 1.00
R4581:Phactr3 UTSW 2 178283172 missense probably damaging 1.00
R4772:Phactr3 UTSW 2 178283936 missense probably damaging 1.00
R4830:Phactr3 UTSW 2 178284018 missense probably damaging 0.98
R5045:Phactr3 UTSW 2 178331619 missense probably damaging 1.00
R5461:Phactr3 UTSW 2 178278901 missense probably benign
R5816:Phactr3 UTSW 2 178302793 missense probably damaging 1.00
R6276:Phactr3 UTSW 2 178279019 missense probably damaging 0.99
R6668:Phactr3 UTSW 2 178332864 missense probably damaging 1.00
R7144:Phactr3 UTSW 2 178302736 missense probably damaging 1.00
R7340:Phactr3 UTSW 2 178334061 missense probably damaging 1.00
R7798:Phactr3 UTSW 2 178283910 missense probably benign 0.19
R8009:Phactr3 UTSW 2 178332944 missense probably damaging 1.00
R8074:Phactr3 UTSW 2 178302796 missense probably damaging 1.00
R8348:Phactr3 UTSW 2 178256142 missense probably benign 0.03
R8530:Phactr3 UTSW 2 178284026 missense probably damaging 1.00
Z1176:Phactr3 UTSW 2 178269374 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTCCCCTGGAATATAAGCAGAAG -3'
(R):5'- ACCTGAATCGGATCGCTGTC -3'

Sequencing Primer
(F):5'- ACCCTGAAGCCAGCCTG -3'
(R):5'- GTCCCCCCCAGTAAAGG -3'
Posted On2016-09-01