Incidental Mutation 'R5442:Cetn4'
ID427216
Institutional Source Beutler Lab
Gene Symbol Cetn4
Ensembl Gene ENSMUSG00000045031
Gene Namecentrin 4
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location37307749-37312708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37309945 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 39 (V39I)
Ref Sequence ENSEMBL: ENSMUSP00000132689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057975] [ENSMUST00000071400] [ENSMUST00000075537] [ENSMUST00000102955] [ENSMUST00000108121] [ENSMUST00000125252] [ENSMUST00000140956]
Predicted Effect probably benign
Transcript: ENSMUST00000057975
SMART Domains Protein: ENSMUSP00000052179
Gene: ENSMUSG00000051444

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 22 153 5.6e-8 PFAM
Pfam:Cpn60_TCP1 299 568 4.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071400
SMART Domains Protein: ENSMUSP00000071349
Gene: ENSMUSG00000045031

DomainStartEndE-ValueType
EFh 28 56 4.74e-3 SMART
EFh 58 86 1.23e-1 SMART
EFh 94 122 2.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075537
AA Change: V91I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074975
Gene: ENSMUSG00000045031
AA Change: V91I

DomainStartEndE-ValueType
EFh 28 56 1.28e-8 SMART
EFh 64 92 7.82e-4 SMART
EFh 93 119 1.11e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102955
AA Change: V91I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100020
Gene: ENSMUSG00000045031
AA Change: V91I

DomainStartEndE-ValueType
EFh 28 56 1.28e-8 SMART
EFh 64 92 7.82e-4 SMART
EFh 101 129 1.23e-1 SMART
EFh 137 165 2.94e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108121
SMART Domains Protein: ENSMUSP00000103756
Gene: ENSMUSG00000051444

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 181 576 3.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125252
AA Change: V39I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129410
Gene: ENSMUSG00000045031
AA Change: V39I

DomainStartEndE-ValueType
EFh 12 40 7.82e-4 SMART
EFh 49 77 1.23e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138710
Predicted Effect probably benign
Transcript: ENSMUST00000140956
AA Change: V39I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132689
Gene: ENSMUSG00000045031
AA Change: V39I

DomainStartEndE-ValueType
EFh 12 40 7.82e-4 SMART
EFh 49 77 1.23e-1 SMART
EFh 85 113 2.94e-8 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Cetn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02390:Cetn4 APN 3 37309156 missense probably damaging 0.99
R1547:Cetn4 UTSW 3 37309451 missense possibly damaging 0.88
R3500:Cetn4 UTSW 3 37309960 missense probably benign 0.16
R4530:Cetn4 UTSW 3 37309945 missense probably benign
R5269:Cetn4 UTSW 3 37309969 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCAAAGTAGGTGCTCTG -3'
(R):5'- AAGTTCAAAATGCGATCATGGC -3'

Sequencing Primer
(F):5'- CTCTGTGATTGCCAGGTCCAG -3'
(R):5'- CATGGCATTATTAAAATATGTCCCCC -3'
Posted On2016-09-01