Incidental Mutation 'R5442:Lrat'
ID427217
Institutional Source Beutler Lab
Gene Symbol Lrat
Ensembl Gene ENSMUSG00000028003
Gene Namelecithin-retinol acyltransferase (phosphatidylcholine-retinol-O-acyltransferase)
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location82892579-82903973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82903220 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 165 (V165M)
Ref Sequence ENSEMBL: ENSMUSP00000029632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029632]
PDB Structure Crystal structure of HRASLS3/LRAT chimeric protein [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029632
AA Change: V165M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029632
Gene: ENSMUSG00000028003
AA Change: V165M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:LRAT 43 174 1.4e-44 PFAM
low complexity region 194 205 N/A INTRINSIC
transmembrane domain 206 228 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156457
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the endoplasmic reticulum, where it catalyzes the esterification of all-trans-retinol into all-trans-retinyl ester. This reaction is an important step in vitamin A metabolism in the visual system. Mutations in this gene have been associated with early-onset severe retinal dystrophy and Leber congenital amaurosis 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit retinol homeostasis abnormalities and are more susceptible to vitamin A deficiency or display impaired vision associated with abnormal retinol metabolism. Males have testicular hypoplasia/atrophy and reduced mature sperm counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Lrat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Lrat APN 3 82903349 missense probably damaging 0.99
R1445:Lrat UTSW 3 82903369 missense probably damaging 1.00
R1491:Lrat UTSW 3 82903342 missense probably benign 0.07
R1735:Lrat UTSW 3 82897110 missense probably benign 0.01
R2419:Lrat UTSW 3 82903685 missense probably damaging 1.00
R4446:Lrat UTSW 3 82896986 missense probably damaging 0.98
R5495:Lrat UTSW 3 82896982 missense probably benign 0.00
R6255:Lrat UTSW 3 82903505 missense probably damaging 1.00
R6468:Lrat UTSW 3 82903492 missense probably damaging 1.00
R6909:Lrat UTSW 3 82903654 missense probably damaging 1.00
R7041:Lrat UTSW 3 82903448 missense probably benign 0.03
R7396:Lrat UTSW 3 82903283 nonsense probably null
R8369:Lrat UTSW 3 82903558 missense probably damaging 0.97
Z1177:Lrat UTSW 3 82903490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAATAGCCTTTCTGCGAGG -3'
(R):5'- CATTTGCAAGGTGGCTAGCATC -3'

Sequencing Primer
(F):5'- TTTCTGCGAGGCAAACTGC -3'
(R):5'- TCCGTGTGGACACAGTAGAG -3'
Posted On2016-09-01