Incidental Mutation 'R5442:Pakap'
ID427218
Institutional Source Beutler Lab
Gene Symbol Pakap
Ensembl Gene ENSMUSG00000089945
Gene Nameparalemmin A kinase anchor protein
SynonymsPalm2Akap2, AF064781, Palm2-Akap2, Gm20459
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5442 (G1)
Quality Score169
Status Not validated
Chromosome4
Chromosomal Location57568179-57896982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57637876 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 18 (P18Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098066] [ENSMUST00000102904] [ENSMUST00000102905] [ENSMUST00000126465] [ENSMUST00000142556]
Predicted Effect probably benign
Transcript: ENSMUST00000098066
SMART Domains Protein: ENSMUSP00000095674
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102904
SMART Domains Protein: ENSMUSP00000099968
Gene: ENSMUSG00000090053

DomainStartEndE-ValueType
Pfam:Paralemmin 66 376 8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102905
SMART Domains Protein: ENSMUSP00000099969
Gene: ENSMUSG00000090053

DomainStartEndE-ValueType
Pfam:Paralemmin 67 376 5.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126465
SMART Domains Protein: ENSMUSP00000130230
Gene: ENSMUSG00000089945

DomainStartEndE-ValueType
Pfam:Paralemmin 67 138 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131201
Predicted Effect probably benign
Transcript: ENSMUST00000142556
SMART Domains Protein: ENSMUSP00000129817
Gene: ENSMUSG00000090053

DomainStartEndE-ValueType
Pfam:Paralemmin 66 136 8.7e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150412
AA Change: P18Q
SMART Domains Protein: ENSMUSP00000117466
Gene: ENSMUSG00000089945
AA Change: P18Q

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
low complexity region 35 59 N/A INTRINSIC
Pfam:Paralemmin 115 269 6.5e-23 PFAM
low complexity region 396 407 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
coiled coil region 499 557 N/A INTRINSIC
Pfam:AKAP2_C 847 1129 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: This locus represents naturally occurring readthrough transcription between the neighboring Palm2 (paralemmin 2) and Akap2 (A kinase (PRKA) anchor protein 2) genes on chromosome 4. The readthrough transcript encodes a fusion protein that shares sequence identity with each individual gene product. Similar readthrough transcription has also been observed in human, as described in PMID: 11478809. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Pakap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Pakap APN 4 57757627 nonsense probably null
IGL01371:Pakap APN 4 57856325 missense probably benign 0.03
IGL01647:Pakap APN 4 57688477 missense possibly damaging 0.82
IGL01733:Pakap APN 4 57856488 missense probably benign 0.01
IGL02677:Pakap APN 4 57856263 missense probably benign 0.01
IGL02696:Pakap APN 4 57854663 missense probably damaging 0.97
IGL03067:Pakap APN 4 57648038 missense probably benign 0.02
IGL03343:Pakap APN 4 57688502 missense probably damaging 1.00
R1913:Pakap UTSW 4 57892963 missense probably damaging 1.00
R2339:Pakap UTSW 4 57883180 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCAAATTAGCCCTGCAC -3'
(R):5'- ACCTGTTCGTCAAGCTGTCG -3'

Sequencing Primer
(F):5'- TTAGCCCTGCACAACACAGAGAG -3'
(R):5'- GTTCGTCAAGCTGTCGTCTCTTC -3'
Posted On2016-09-01