Mutagenetix > Incidental Mutation

Incidental Mutation 'R5442:Astn2'

427219

Institutional Source

Beutler Lab

Gene Symbol

Astn2

Ensembl Gene

ENSMUSG00000028373

Gene Name

astrotactin 2

Synonyms

1d8, Astnl

MMRRC Submission

043007-MU

Accession Numbers

Genbank: NM _019514.3, NM _207109.2; Ensembl: ENSMUST 00000068214, ENSMUST 00000084496

Is this an essential gene?

Probably non essential (E-score: 0.080) question?

Stock #

R5442 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65380803-66404611 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 65581786 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 955 (S955R)

Ref Sequence

ENSEMBL: ENSMUSP00000065786 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]

AlphaFold

Q80Z10

Predicted Effect

possibly damaging
Transcript: ENSMUST00000068214
AA Change: S955R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: S955R

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	342	361	N/A	INTRINSIC
low complexity region	393	404	N/A	INTRINSIC
low complexity region	432	437	N/A	INTRINSIC
transmembrane domain	443	465	N/A	INTRINSIC
EGF_like	526	563	2.92e1	SMART
Blast:EGF_like	667	708	2e-18	BLAST
EGF_like	715	764	4.03e1	SMART
MACPF	864	1048	2.88e-55	SMART
FN3	1079	1191	2.41e0	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084496
AA Change: S903R

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: S903R

Domain	Start	End	E-Value	Type
signal peptide	1	51	N/A	INTRINSIC
low complexity region	87	127	N/A	INTRINSIC
transmembrane domain	219	241	N/A	INTRINSIC
low complexity region	303	312	N/A	INTRINSIC
low complexity region	341	352	N/A	INTRINSIC
low complexity region	380	385	N/A	INTRINSIC
transmembrane domain	391	413	N/A	INTRINSIC
EGF_like	474	511	2.92e1	SMART
Blast:EGF_like	615	656	2e-18	BLAST
EGF_like	663	712	4.03e1	SMART
MACPF	812	996	2.88e-55	SMART
FN3	1027	1139	2.41e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,018,768	M114T	probably benign	Het
Ablim3	A	T	18: 61,857,225		probably null	Het
Adcy10	A	G	1: 165,513,140	D238G	probably benign	Het
Casc3	A	G	11: 98,821,471	E112G	probably damaging	Het
Cetn4	C	T	3: 37,309,945	V39I	probably benign	Het
Commd4	A	G	9: 57,156,806	V37A	possibly damaging	Het
Dyrk2	T	C	10: 118,860,738	Q205R	possibly damaging	Het
Gal3st4	A	G	5: 138,265,780	V319A	possibly damaging	Het
Gm14085	A	G	2: 122,486,869	N36S	probably benign	Het
Inpp5d	G	A	1: 87,718,066	A1058T	probably benign	Het
Lpin3	A	G	2: 160,905,016	Y781C	probably damaging	Het
Lrat	C	T	3: 82,903,220	V165M	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Nlrp6	T	C	7: 140,922,190	S142P	probably benign	Het
Oas1a	T	C	5: 120,897,206	T349A	probably benign	Het
Olfr1033	T	C	2: 86,041,951	V212A	probably benign	Het
Olfr110	A	T	17: 37,499,439	I263F	probably damaging	Het
Olfr671	A	T	7: 104,975,228	F252L	possibly damaging	Het
Olfr898	T	A	9: 38,349,862	S260T	probably benign	Het
Pakap	C	A	4: 57,637,876	P18Q	probably null	Het
Pcdha2	T	C	18: 36,939,862	V182A	probably benign	Het
Phactr3	A	G	2: 178,142,461	D26G	probably benign	Het
Phrf1	G	A	7: 141,240,937	R159H	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rab3ip	T	C	10: 116,918,848	T268A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rem1	A	G	2: 152,628,057		probably null	Het
Syne1	A	G	10: 5,343,473	M1286T	probably benign	Het
Thsd7a	T	C	6: 12,748,800	T52A	probably benign	Het
Tmem135	A	T	7: 89,144,664	F390Y	probably damaging	Het
Trio	T	C	15: 27,856,194	D696G	probably benign	Het
Ttll11	T	C	2: 35,903,123	*191W	probably null	Het
Ubr4	A	G	4: 139,407,772	D805G	probably damaging	Het
Usp9y	A	G	Y: 1,336,467	I1469T	possibly damaging	Het
Vmn1r70	G	T	7: 10,633,950	A122S	possibly damaging	Het
Vmn2r78	G	T	7: 86,920,122	L74F	possibly damaging	Het
Wdfy3	T	C	5: 101,896,559	E1860G	probably benign	Het

Other mutations in Astn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Astn2	APN	4	66185187	missense	unknown
IGL01657:Astn2	APN	4	65651949	missense	probably damaging	0.99
IGL01747:Astn2	APN	4	65794618	missense	probably benign	0.17
IGL02008:Astn2	APN	4	66059153	missense	probably damaging	1.00
IGL02215:Astn2	APN	4	66266234	missense	unknown
IGL02484:Astn2	APN	4	65992279	splice site	probably benign
IGL02494:Astn2	APN	4	65992348	missense	probably benign	0.23
IGL02792:Astn2	APN	4	65644821	missense	probably benign	0.32
IGL03248:Astn2	APN	4	65746293	splice site	probably benign
IGL03409:Astn2	APN	4	65435186	missense	possibly damaging	0.46
B6584:Astn2	UTSW	4	65992387	missense	probably damaging	0.99
R0015:Astn2	UTSW	4	66266382	critical splice acceptor site	probably null
R0015:Astn2	UTSW	4	66266382	critical splice acceptor site	probably null
R0092:Astn2	UTSW	4	66403982	missense	unknown
R0245:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R0528:Astn2	UTSW	4	65644882	splice site	probably benign
R0586:Astn2	UTSW	4	66185142	missense	unknown
R0652:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R0880:Astn2	UTSW	4	65648330	missense	probably damaging	0.99
R0931:Astn2	UTSW	4	65648293	missense	probably damaging	0.99
R1353:Astn2	UTSW	4	66266335	missense	unknown
R1700:Astn2	UTSW	4	65746354	nonsense	probably null
R1934:Astn2	UTSW	4	65435189	missense	probably damaging	0.99
R2017:Astn2	UTSW	4	65540941	missense	probably damaging	0.99
R2101:Astn2	UTSW	4	65581686	nonsense	probably null
R2158:Astn2	UTSW	4	66404254	missense	unknown
R2907:Astn2	UTSW	4	65644856	missense	possibly damaging	0.92
R2923:Astn2	UTSW	4	65913773	missense	probably damaging	1.00
R2938:Astn2	UTSW	4	65992313	missense	possibly damaging	0.92
R3033:Astn2	UTSW	4	65644706	missense	probably damaging	1.00
R3933:Astn2	UTSW	4	66403955	missense	unknown
R4151:Astn2	UTSW	4	65729320	critical splice donor site	probably null
R4230:Astn2	UTSW	4	65911682	missense	probably damaging	0.99
R4497:Astn2	UTSW	4	66119063	intron	probably benign
R4717:Astn2	UTSW	4	65644754	missense	possibly damaging	0.86
R4844:Astn2	UTSW	4	65644730	missense	possibly damaging	0.90
R4928:Astn2	UTSW	4	65729407	missense	probably damaging	0.98
R5374:Astn2	UTSW	4	65397005	missense	probably damaging	0.96
R5694:Astn2	UTSW	4	65950138	missense	probably damaging	1.00
R5756:Astn2	UTSW	4	66119188	intron	probably benign
R5763:Astn2	UTSW	4	65729331	missense	probably benign	0.14
R6089:Astn2	UTSW	4	65794573	missense	probably damaging	0.96
R6990:Astn2	UTSW	4	65992303	missense	possibly damaging	0.82
R7304:Astn2	UTSW	4	66185375	missense	unknown
R7325:Astn2	UTSW	4	65542669	missense	probably benign	0.33
R7356:Astn2	UTSW	4	66185266	missense	unknown
R7414:Astn2	UTSW	4	65540956	missense	possibly damaging	0.85
R7755:Astn2	UTSW	4	65794558	missense	probably damaging	0.99
R7887:Astn2	UTSW	4	65644866	missense	possibly damaging	0.51
R8027:Astn2	UTSW	4	65540971	missense	possibly damaging	0.86
R8046:Astn2	UTSW	4	66266350	nonsense	probably null
R8188:Astn2	UTSW	4	66059181	missense	unknown
R8271:Astn2	UTSW	4	65992426	missense	unknown
R8274:Astn2	UTSW	4	65651861	critical splice donor site	probably null
R8505:Astn2	UTSW	4	65381588	missense	unknown
R8815:Astn2	UTSW	4	65912597	missense	possibly damaging	0.96
R8989:Astn2	UTSW	4	65581653	missense	possibly damaging	0.53
R9013:Astn2	UTSW	4	65992347	missense	probably benign	0.23
R9127:Astn2	UTSW	4	66403927	missense	unknown
R9255:Astn2	UTSW	4	65644848	nonsense	probably null
R9297:Astn2	UTSW	4	65542723	missense	possibly damaging	0.85
R9320:Astn2	UTSW	4	66404149	missense	unknown
R9349:Astn2	UTSW	4	66266255	missense	unknown
R9399:Astn2	UTSW	4	65746351	missense	possibly damaging	0.71
R9572:Astn2	UTSW	4	65381635	missense	unknown
R9573:Astn2	UTSW	4	65648354	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- CCACACGGTTTATCTCCAGCAG -3'
(R):5'- CTTAACCCTTTGGCCTGTGG -3'

Sequencing Primer
(F):5'- GGTTTATCTCCAGCAGCACTG -3'
(R):5'- TGGTTTTTCCAAAGCATGATGAG -3'

Posted On

2016-09-01