Incidental Mutation 'R5442:Astn2'
ID 427219
Institutional Source Beutler Lab
Gene Symbol Astn2
Ensembl Gene ENSMUSG00000028373
Gene Name astrotactin 2
Synonyms 1d8, Astnl
MMRRC Submission 043007-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5442 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 65299040-66322774 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 65500023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 955 (S955R)
Ref Sequence ENSEMBL: ENSMUSP00000065786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068214] [ENSMUST00000084496]
AlphaFold Q80Z10
Predicted Effect possibly damaging
Transcript: ENSMUST00000068214
AA Change: S955R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000065786
Gene: ENSMUSG00000028373
AA Change: S955R

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 393 404 N/A INTRINSIC
low complexity region 432 437 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
EGF_like 526 563 2.92e1 SMART
Blast:EGF_like 667 708 2e-18 BLAST
EGF_like 715 764 4.03e1 SMART
MACPF 864 1048 2.88e-55 SMART
FN3 1079 1191 2.41e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084496
AA Change: S903R

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081540
Gene: ENSMUSG00000028373
AA Change: S903R

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 87 127 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
low complexity region 303 312 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
low complexity region 380 385 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
EGF_like 474 511 2.92e1 SMART
Blast:EGF_like 615 656 2e-18 BLAST
EGF_like 663 712 4.03e1 SMART
MACPF 812 996 2.88e-55 SMART
FN3 1027 1139 2.41e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 119,909,594 (GRCm39) M114T probably benign Het
Ablim3 A T 18: 61,990,296 (GRCm39) probably null Het
Adcy10 A G 1: 165,340,709 (GRCm39) D238G probably benign Het
Casc3 A G 11: 98,712,297 (GRCm39) E112G probably damaging Het
Cetn4 C T 3: 37,364,094 (GRCm39) V39I probably benign Het
Commd4 A G 9: 57,064,090 (GRCm39) V37A possibly damaging Het
Dyrk2 T C 10: 118,696,643 (GRCm39) Q205R possibly damaging Het
Gal3st4 A G 5: 138,264,042 (GRCm39) V319A possibly damaging Het
Inpp5d G A 1: 87,645,788 (GRCm39) A1058T probably benign Het
Lpin3 A G 2: 160,746,936 (GRCm39) Y781C probably damaging Het
Lrat C T 3: 82,810,527 (GRCm39) V165M probably damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Nlrp6 T C 7: 140,502,103 (GRCm39) S142P probably benign Het
Oas1a T C 5: 121,035,269 (GRCm39) T349A probably benign Het
Or52e8 A T 7: 104,624,435 (GRCm39) F252L possibly damaging Het
Or5m3b T C 2: 85,872,295 (GRCm39) V212A probably benign Het
Or5v1 A T 17: 37,810,330 (GRCm39) I263F probably damaging Het
Or8c20 T A 9: 38,261,158 (GRCm39) S260T probably benign Het
Pakap C A 4: 57,637,876 (GRCm39) P18Q probably null Het
Pcdha2 T C 18: 37,072,915 (GRCm39) V182A probably benign Het
Phactr3 A G 2: 177,784,254 (GRCm39) D26G probably benign Het
Phrf1 G A 7: 140,820,850 (GRCm39) R159H probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rab3ip T C 10: 116,754,753 (GRCm39) T268A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rem1 A G 2: 152,469,977 (GRCm39) probably null Het
Slc28a2b A G 2: 122,317,350 (GRCm39) N36S probably benign Het
Syne1 A G 10: 5,293,473 (GRCm39) M1286T probably benign Het
Thsd7a T C 6: 12,748,799 (GRCm39) T52A probably benign Het
Tmem135 A T 7: 88,793,872 (GRCm39) F390Y probably damaging Het
Trio T C 15: 27,856,280 (GRCm39) D696G probably benign Het
Ttll11 T C 2: 35,793,135 (GRCm39) *191W probably null Het
Ubr4 A G 4: 139,135,083 (GRCm39) D805G probably damaging Het
Usp9y A G Y: 1,336,467 (GRCm39) I1469T possibly damaging Het
Vmn1r70 G T 7: 10,367,877 (GRCm39) A122S possibly damaging Het
Vmn2r78 G T 7: 86,569,330 (GRCm39) L74F possibly damaging Het
Wdfy3 T C 5: 102,044,425 (GRCm39) E1860G probably benign Het
Other mutations in Astn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Astn2 APN 4 66,103,424 (GRCm39) missense unknown
IGL01657:Astn2 APN 4 65,570,186 (GRCm39) missense probably damaging 0.99
IGL01747:Astn2 APN 4 65,712,855 (GRCm39) missense probably benign 0.17
IGL02008:Astn2 APN 4 65,977,390 (GRCm39) missense probably damaging 1.00
IGL02215:Astn2 APN 4 66,184,471 (GRCm39) missense unknown
IGL02484:Astn2 APN 4 65,910,516 (GRCm39) splice site probably benign
IGL02494:Astn2 APN 4 65,910,585 (GRCm39) missense probably benign 0.23
IGL02792:Astn2 APN 4 65,563,058 (GRCm39) missense probably benign 0.32
IGL03248:Astn2 APN 4 65,664,530 (GRCm39) splice site probably benign
IGL03409:Astn2 APN 4 65,353,423 (GRCm39) missense possibly damaging 0.46
B6584:Astn2 UTSW 4 65,910,624 (GRCm39) missense probably damaging 0.99
R0015:Astn2 UTSW 4 66,184,619 (GRCm39) critical splice acceptor site probably null
R0015:Astn2 UTSW 4 66,184,619 (GRCm39) critical splice acceptor site probably null
R0092:Astn2 UTSW 4 66,322,219 (GRCm39) missense unknown
R0245:Astn2 UTSW 4 65,712,795 (GRCm39) missense probably damaging 0.99
R0528:Astn2 UTSW 4 65,563,119 (GRCm39) splice site probably benign
R0586:Astn2 UTSW 4 66,103,379 (GRCm39) missense unknown
R0652:Astn2 UTSW 4 65,712,795 (GRCm39) missense probably damaging 0.99
R0880:Astn2 UTSW 4 65,566,567 (GRCm39) missense probably damaging 0.99
R0931:Astn2 UTSW 4 65,566,530 (GRCm39) missense probably damaging 0.99
R1353:Astn2 UTSW 4 66,184,572 (GRCm39) missense unknown
R1700:Astn2 UTSW 4 65,664,591 (GRCm39) nonsense probably null
R1934:Astn2 UTSW 4 65,353,426 (GRCm39) missense probably damaging 0.99
R2017:Astn2 UTSW 4 65,459,178 (GRCm39) missense probably damaging 0.99
R2101:Astn2 UTSW 4 65,499,923 (GRCm39) nonsense probably null
R2158:Astn2 UTSW 4 66,322,491 (GRCm39) missense unknown
R2907:Astn2 UTSW 4 65,563,093 (GRCm39) missense possibly damaging 0.92
R2923:Astn2 UTSW 4 65,832,010 (GRCm39) missense probably damaging 1.00
R2938:Astn2 UTSW 4 65,910,550 (GRCm39) missense possibly damaging 0.92
R3033:Astn2 UTSW 4 65,562,943 (GRCm39) missense probably damaging 1.00
R3933:Astn2 UTSW 4 66,322,192 (GRCm39) missense unknown
R4151:Astn2 UTSW 4 65,647,557 (GRCm39) critical splice donor site probably null
R4230:Astn2 UTSW 4 65,829,919 (GRCm39) missense probably damaging 0.99
R4497:Astn2 UTSW 4 66,037,300 (GRCm39) intron probably benign
R4717:Astn2 UTSW 4 65,562,991 (GRCm39) missense possibly damaging 0.86
R4844:Astn2 UTSW 4 65,562,967 (GRCm39) missense possibly damaging 0.90
R4928:Astn2 UTSW 4 65,647,644 (GRCm39) missense probably damaging 0.98
R5374:Astn2 UTSW 4 65,315,242 (GRCm39) missense probably damaging 0.96
R5694:Astn2 UTSW 4 65,868,375 (GRCm39) missense probably damaging 1.00
R5756:Astn2 UTSW 4 66,037,425 (GRCm39) intron probably benign
R5763:Astn2 UTSW 4 65,647,568 (GRCm39) missense probably benign 0.14
R6089:Astn2 UTSW 4 65,712,810 (GRCm39) missense probably damaging 0.96
R6990:Astn2 UTSW 4 65,910,540 (GRCm39) missense possibly damaging 0.82
R7304:Astn2 UTSW 4 66,103,612 (GRCm39) missense unknown
R7325:Astn2 UTSW 4 65,460,906 (GRCm39) missense probably benign 0.33
R7356:Astn2 UTSW 4 66,103,503 (GRCm39) missense unknown
R7414:Astn2 UTSW 4 65,459,193 (GRCm39) missense possibly damaging 0.85
R7755:Astn2 UTSW 4 65,712,795 (GRCm39) missense probably damaging 0.99
R7887:Astn2 UTSW 4 65,563,103 (GRCm39) missense possibly damaging 0.51
R8027:Astn2 UTSW 4 65,459,208 (GRCm39) missense possibly damaging 0.86
R8046:Astn2 UTSW 4 66,184,587 (GRCm39) nonsense probably null
R8188:Astn2 UTSW 4 65,977,418 (GRCm39) missense unknown
R8271:Astn2 UTSW 4 65,910,663 (GRCm39) missense unknown
R8274:Astn2 UTSW 4 65,570,098 (GRCm39) critical splice donor site probably null
R8505:Astn2 UTSW 4 65,299,825 (GRCm39) missense unknown
R8815:Astn2 UTSW 4 65,830,834 (GRCm39) missense possibly damaging 0.96
R8989:Astn2 UTSW 4 65,499,890 (GRCm39) missense possibly damaging 0.53
R9013:Astn2 UTSW 4 65,910,584 (GRCm39) missense probably benign 0.23
R9127:Astn2 UTSW 4 66,322,164 (GRCm39) missense unknown
R9255:Astn2 UTSW 4 65,563,085 (GRCm39) nonsense probably null
R9297:Astn2 UTSW 4 65,460,960 (GRCm39) missense possibly damaging 0.85
R9320:Astn2 UTSW 4 66,322,386 (GRCm39) missense unknown
R9349:Astn2 UTSW 4 66,184,492 (GRCm39) missense unknown
R9399:Astn2 UTSW 4 65,664,588 (GRCm39) missense possibly damaging 0.71
R9572:Astn2 UTSW 4 65,299,872 (GRCm39) missense unknown
R9573:Astn2 UTSW 4 65,566,591 (GRCm39) missense probably benign 0.08
R9674:Astn2 UTSW 4 65,460,963 (GRCm39) missense probably damaging 0.98
R9722:Astn2 UTSW 4 65,831,978 (GRCm39) missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CCACACGGTTTATCTCCAGCAG -3'
(R):5'- CTTAACCCTTTGGCCTGTGG -3'

Sequencing Primer
(F):5'- GGTTTATCTCCAGCAGCACTG -3'
(R):5'- TGGTTTTTCCAAAGCATGATGAG -3'
Posted On 2016-09-01