Incidental Mutation 'R5442:Tmem135'
ID427227
Institutional Source Beutler Lab
Gene Symbol Tmem135
Ensembl Gene ENSMUSG00000039428
Gene Nametransmembrane protein 135
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location89139714-89404222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89144664 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 390 (F390Y)
Ref Sequence ENSEMBL: ENSMUSP00000042783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041968] [ENSMUST00000117852]
Predicted Effect probably damaging
Transcript: ENSMUST00000041968
AA Change: F390Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042783
Gene: ENSMUSG00000039428
AA Change: F390Y

DomainStartEndE-ValueType
Pfam:TMEM135_C_rich 9 142 2.2e-84 PFAM
transmembrane domain 147 169 N/A INTRINSIC
Pfam:Tim17 249 370 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117852
SMART Domains Protein: ENSMUSP00000114097
Gene: ENSMUSG00000039428

DomainStartEndE-ValueType
low complexity region 52 65 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
transmembrane domain 96 115 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 299 321 N/A INTRINSIC
transmembrane domain 331 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207335
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Tmem135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Tmem135 APN 7 89151438 missense probably damaging 1.00
IGL01730:Tmem135 APN 7 89148044 missense possibly damaging 0.82
IGL01933:Tmem135 APN 7 89143857 unclassified probably benign
IGL02177:Tmem135 APN 7 89338453 missense probably damaging 1.00
IGL02305:Tmem135 APN 7 89165123 critical splice donor site probably null
IGL02747:Tmem135 APN 7 89144670 missense probably damaging 0.98
IGL02801:Tmem135 APN 7 89154125 missense probably benign 0.13
IGL03353:Tmem135 APN 7 89141953 missense probably damaging 1.00
skim UTSW 7 89196127 nonsense probably null
R0631:Tmem135 UTSW 7 89143788 nonsense probably null
R0657:Tmem135 UTSW 7 89144682 missense probably damaging 0.96
R2233:Tmem135 UTSW 7 89154074 missense probably damaging 1.00
R3118:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R3119:Tmem135 UTSW 7 89147797 missense probably benign 0.02
R5094:Tmem135 UTSW 7 89143793 missense probably damaging 1.00
R5225:Tmem135 UTSW 7 89196127 nonsense probably null
R5248:Tmem135 UTSW 7 89147992 missense probably damaging 1.00
R5356:Tmem135 UTSW 7 89305515 missense probably benign 0.06
R5372:Tmem135 UTSW 7 89165174 splice site probably null
R5789:Tmem135 UTSW 7 89196122 missense possibly damaging 0.73
R5863:Tmem135 UTSW 7 89147968 critical splice donor site probably null
R6158:Tmem135 UTSW 7 89156444 missense probably benign 0.12
R6383:Tmem135 UTSW 7 89144670 missense probably damaging 0.98
R6416:Tmem135 UTSW 7 89147794 missense probably benign
R6659:Tmem135 UTSW 7 89307163 missense probably benign 0.07
R6659:Tmem135 UTSW 7 89307164 nonsense probably null
R6731:Tmem135 UTSW 7 89243964 missense possibly damaging 0.96
R7545:Tmem135 UTSW 7 89305519 missense probably damaging 1.00
R7626:Tmem135 UTSW 7 89156510 splice site probably null
R8089:Tmem135 UTSW 7 89156495 missense probably damaging 0.99
R8447:Tmem135 UTSW 7 89154032 missense probably damaging 1.00
R8703:Tmem135 UTSW 7 89158962 missense probably benign 0.00
R8750:Tmem135 UTSW 7 89307248 missense probably damaging 0.99
R8758:Tmem135 UTSW 7 89305513 missense probably benign 0.04
R8806:Tmem135 UTSW 7 89147978 missense probably benign 0.25
R8807:Tmem135 UTSW 7 89147978 missense probably benign 0.25
R8808:Tmem135 UTSW 7 89147978 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGTTCAGTGCTTTCAGACATGC -3'
(R):5'- GGAAGATGTGAATGATTGAGCTTC -3'

Sequencing Primer
(F):5'- AGACATGCAAGGTCTTCTGC -3'
(R):5'- TATACTCGTGGAACTCTCTACTGAG -3'
Posted On2016-09-01