Incidental Mutation 'R5442:Olfr671'
ID427228
Institutional Source Beutler Lab
Gene Symbol Olfr671
Ensembl Gene ENSMUSG00000094531
Gene Nameolfactory receptor 671
SynonymsGA_x6K02T2PBJ9-7604826-7603885, MOR32-12
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104972896-104979126 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104975228 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 252 (F252L)
Ref Sequence ENSEMBL: ENSMUSP00000077774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078710] [ENSMUST00000210963] [ENSMUST00000217091]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078710
AA Change: F252L

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077774
Gene: ENSMUSG00000094531
AA Change: F252L

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.4e-117 PFAM
Pfam:7TM_GPCR_Srsx 37 308 3.7e-7 PFAM
Pfam:7tm_1 43 293 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210963
AA Change: F256L

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217091
AA Change: F256L

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Olfr671
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Olfr671 APN 7 104975986 unclassified probably null
IGL02154:Olfr671 APN 7 104975981 start codon destroyed probably null 0.14
IGL02308:Olfr671 APN 7 104975458 missense possibly damaging 0.84
IGL02794:Olfr671 APN 7 104975389 missense probably benign
R0919:Olfr671 UTSW 7 104975312 nonsense probably null
R1819:Olfr671 UTSW 7 104975398 missense probably benign 0.01
R1972:Olfr671 UTSW 7 104975899 missense possibly damaging 0.63
R2025:Olfr671 UTSW 7 104975244 missense probably benign 0.01
R4910:Olfr671 UTSW 7 104975479 missense possibly damaging 0.88
R5554:Olfr671 UTSW 7 104975982 start codon destroyed probably null 0.99
R5932:Olfr671 UTSW 7 104975655 missense probably damaging 1.00
R6683:Olfr671 UTSW 7 104975968 missense probably benign
R6962:Olfr671 UTSW 7 104975373 missense probably benign 0.00
R7000:Olfr671 UTSW 7 104975131 missense probably damaging 1.00
R7059:Olfr671 UTSW 7 104976017 splice site probably null
R7276:Olfr671 UTSW 7 104975650 missense possibly damaging 0.62
R7425:Olfr671 UTSW 7 104975061 nonsense probably null
R7688:Olfr671 UTSW 7 104975125 missense possibly damaging 0.60
R8043:Olfr671 UTSW 7 104975873 nonsense probably null
R8074:Olfr671 UTSW 7 104975727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAACAAACTGCAAAGTGC -3'
(R):5'- CTTGTGCCAGCATCAAAGTC -3'

Sequencing Primer
(F):5'- CAAACTGCAAAGTGCTATTGGC -3'
(R):5'- GTCAACATCATGTTTGGTCTTAGC -3'
Posted On2016-09-01