Incidental Mutation 'R5442:Nlrp6'
ID427230
Institutional Source Beutler Lab
Gene Symbol Nlrp6
Ensembl Gene ENSMUSG00000038745
Gene NameNLR family, pyrin domain containing 6
SynonymsNalp6
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140920902-140929192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140922190 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 142 (S142P)
Ref Sequence ENSEMBL: ENSMUSP00000139170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106045] [ENSMUST00000183845] [ENSMUST00000184560]
Predicted Effect probably benign
Transcript: ENSMUST00000106045
AA Change: S112P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000101660
Gene: ENSMUSG00000038745
AA Change: S112P

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 8.6e-44 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 675 697 N/A INTRINSIC
internal_repeat_1 715 763 9.43e-6 PROSPERO
internal_repeat_1 828 876 9.43e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183761
Predicted Effect probably benign
Transcript: ENSMUST00000183845
AA Change: S112P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139357
Gene: ENSMUSG00000038745
AA Change: S112P

DomainStartEndE-ValueType
PYRIN 15 96 5.44e-27 SMART
low complexity region 158 169 N/A INTRINSIC
Pfam:NACHT 194 363 5.5e-43 PFAM
coiled coil region 590 617 N/A INTRINSIC
low complexity region 680 694 N/A INTRINSIC
internal_repeat_1 702 750 1.26e-5 PROSPERO
internal_repeat_1 815 863 1.26e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000184560
AA Change: S142P

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139170
Gene: ENSMUSG00000038745
AA Change: S142P

DomainStartEndE-ValueType
PYRIN 45 126 5.44e-27 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:NACHT 224 393 8.2e-43 PFAM
coiled coil region 620 647 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
internal_repeat_1 732 780 1.55e-5 PROSPERO
internal_repeat_1 845 893 1.55e-5 PROSPERO
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene binds arginine-vasopressin and may be involved in the arginine-vasopressin-mediated regulation of renal salt-water balance. The encoded protein also mediates inflammatory responses in the colon to allow recovery from intestinal epithelial damage and protects against tumorigenesis and the development of colitis. Finally, this protein can increase activation of NF-kappa-B, activation of CASP1 through interaction with ASC, and cAMP accumulation. [provided by RefSeq, Feb 2013]
PHENOTYPE: Nullizygous mutations lead to altered colonic microbiota, increased susceptibility to induced colitis and/or inflammation-associated colon tumorigenesis. Homozygotes for a null allele show lower blood pressure and sex-specific changes in urine concentrating ability, cognition, and anxiety behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Nlrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Nlrp6 APN 7 140923124 missense probably damaging 1.00
IGL01066:Nlrp6 APN 7 140921796 missense possibly damaging 0.88
IGL01966:Nlrp6 APN 7 140925190 missense probably damaging 1.00
IGL02625:Nlrp6 APN 7 140923500 missense probably benign 0.00
IGL02792:Nlrp6 APN 7 140922435 missense probably damaging 0.97
IGL02813:Nlrp6 APN 7 140923420 missense possibly damaging 0.86
IGL03140:Nlrp6 APN 7 140927487 missense probably benign 0.01
R0608:Nlrp6 UTSW 7 140923486 nonsense probably null
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1404:Nlrp6 UTSW 7 140924113 small deletion probably benign
R1472:Nlrp6 UTSW 7 140923495 missense probably damaging 1.00
R1587:Nlrp6 UTSW 7 140923046 missense probably damaging 1.00
R1843:Nlrp6 UTSW 7 140923093 missense probably damaging 1.00
R1959:Nlrp6 UTSW 7 140924113 small deletion probably benign
R2097:Nlrp6 UTSW 7 140923204 missense probably damaging 1.00
R2118:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2119:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2120:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2121:Nlrp6 UTSW 7 140926444 missense probably benign 0.11
R2290:Nlrp6 UTSW 7 140922163 missense probably damaging 1.00
R3546:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3547:Nlrp6 UTSW 7 140926769 missense probably benign 0.00
R3970:Nlrp6 UTSW 7 140921655 missense probably damaging 1.00
R4483:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4484:Nlrp6 UTSW 7 140921781 missense probably damaging 1.00
R4869:Nlrp6 UTSW 7 140924093 missense probably damaging 1.00
R4962:Nlrp6 UTSW 7 140923584 missense probably damaging 0.99
R5436:Nlrp6 UTSW 7 140922717 nonsense probably null
R5924:Nlrp6 UTSW 7 140923490 missense probably damaging 1.00
R5936:Nlrp6 UTSW 7 140922812 nonsense probably null
R6124:Nlrp6 UTSW 7 140923247 missense probably damaging 1.00
R6455:Nlrp6 UTSW 7 140927509 missense possibly damaging 0.65
R6480:Nlrp6 UTSW 7 140927443 missense possibly damaging 0.93
R6873:Nlrp6 UTSW 7 140923520 missense probably benign 0.01
R7061:Nlrp6 UTSW 7 140922867 missense probably benign 0.36
R7350:Nlrp6 UTSW 7 140921278 start gained probably benign
R7532:Nlrp6 UTSW 7 140925184 missense probably benign 0.00
R7752:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R7901:Nlrp6 UTSW 7 140927440 missense possibly damaging 0.92
R8098:Nlrp6 UTSW 7 140923255 missense probably damaging 1.00
R8381:Nlrp6 UTSW 7 140923841 missense possibly damaging 0.47
R8513:Nlrp6 UTSW 7 140922830 missense possibly damaging 0.83
V7732:Nlrp6 UTSW 7 140926648 splice site probably benign
Z1176:Nlrp6 UTSW 7 140922721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCCTTGGGAAGATCAAC -3'
(R):5'- TGCCGCCACTATGGAATCAC -3'

Sequencing Primer
(F):5'- GGGAAGATCAACTTTGTCCACTC -3'
(R):5'- TCTAAATCTGGGCTCCCT -3'
Posted On2016-09-01