Incidental Mutation 'R5442:Olfr898'
ID427232
Institutional Source Beutler Lab
Gene Symbol Olfr898
Ensembl Gene ENSMUSG00000094588
Gene Nameolfactory receptor 898
SynonymsGA_x6K02T2PVTD-32037624-32038565, MOR170-3
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38348411-38352919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38349862 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 260 (S260T)
Ref Sequence ENSEMBL: ENSMUSP00000075824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076504] [ENSMUST00000216304] [ENSMUST00000217063]
Predicted Effect probably benign
Transcript: ENSMUST00000076504
AA Change: S260T

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075824
Gene: ENSMUSG00000094588
AA Change: S260T

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 2.2e-47 PFAM
Pfam:7tm_1 47 313 1.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216304
AA Change: S254T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217063
AA Change: S254T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Olfr898
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr898 APN 9 38349805 missense possibly damaging 0.95
IGL02477:Olfr898 APN 9 38349125 missense probably benign 0.16
IGL02858:Olfr898 APN 9 38349173 missense probably benign 0.04
PIT4362001:Olfr898 UTSW 9 38349198 missense probably benign 0.34
R0060:Olfr898 UTSW 9 38349512 missense probably benign 0.23
R0518:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0521:Olfr898 UTSW 9 38349203 missense probably damaging 0.99
R0622:Olfr898 UTSW 9 38349371 missense possibly damaging 0.74
R0898:Olfr898 UTSW 9 38349442 missense probably damaging 0.97
R1562:Olfr898 UTSW 9 38349362 nonsense probably null
R3903:Olfr898 UTSW 9 38349658 nonsense probably null
R4375:Olfr898 UTSW 9 38349169 missense probably benign
R4459:Olfr898 UTSW 9 38349992 missense probably damaging 1.00
R4762:Olfr898 UTSW 9 38349281 missense probably damaging 1.00
R4943:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5033:Olfr898 UTSW 9 38349628 missense probably damaging 1.00
R5863:Olfr898 UTSW 9 38349787 missense probably benign 0.09
R5988:Olfr898 UTSW 9 38349749 missense probably benign 0.30
R7077:Olfr898 UTSW 9 38349970 missense probably damaging 1.00
R7509:Olfr898 UTSW 9 38349572 missense probably benign 0.26
R7709:Olfr898 UTSW 9 38349277 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGTACCAGCACCTATGTCAACG -3'
(R):5'- GGGGCAGGACTATAAAATCACC -3'

Sequencing Primer
(F):5'- GCACCTATGTCAACGAGCTTGTAAG -3'
(R):5'- AAATCACCACTGTTCATTCAGCTTG -3'
Posted On2016-09-01