Incidental Mutation 'R5442:R3hdm4'
ID427235
Institutional Source Beutler Lab
Gene Symbol R3hdm4
Ensembl Gene ENSMUSG00000035781
Gene NameR3H domain containing 4
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79910052-79921208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79912458 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 162 (E162K)
Ref Sequence ENSEMBL: ENSMUSP00000132266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045529] [ENSMUST00000045628] [ENSMUST00000105378] [ENSMUST00000164705] [ENSMUST00000165684] [ENSMUST00000166964] [ENSMUST00000170409] [ENSMUST00000171416] [ENSMUST00000181321] [ENSMUST00000217976] [ENSMUST00000218750] [ENSMUST00000219867] [ENSMUST00000218970]
Predicted Effect probably benign
Transcript: ENSMUST00000045529
SMART Domains Protein: ENSMUSP00000040516
Gene: ENSMUSG00000035773

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 53 338 1.7e-6 PFAM
Pfam:7tm_1 59 323 7e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000045628
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044570
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 1.2e-35 PFAM
Pfam:R3H 181 244 7.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105378
SMART Domains Protein: ENSMUSP00000101017
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
WD40 94 133 1.05e-7 SMART
Blast:WD40 143 169 4e-8 BLAST
low complexity region 206 217 N/A INTRINSIC
WD40 226 267 1.53e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163125
Predicted Effect probably benign
Transcript: ENSMUST00000164705
SMART Domains Protein: ENSMUSP00000129229
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 172 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165684
SMART Domains Protein: ENSMUSP00000129375
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
low complexity region 13 25 N/A INTRINSIC
WD40 95 134 1.05e-7 SMART
Blast:WD40 144 170 4e-8 BLAST
low complexity region 207 218 N/A INTRINSIC
WD40 227 268 1.53e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166964
SMART Domains Protein: ENSMUSP00000128463
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 59 98 1.05e-7 SMART
Pfam:Med16 108 162 2.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170409
SMART Domains Protein: ENSMUSP00000126729
Gene: ENSMUSG00000013833

DomainStartEndE-ValueType
WD40 10 49 1.05e-7 SMART
Pfam:Med16 59 105 1.1e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171416
AA Change: E162K

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132266
Gene: ENSMUSG00000035781
AA Change: E162K

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
Pfam:R3H-assoc 43 177 4.9e-39 PFAM
Pfam:R3H 183 243 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178620
Predicted Effect probably benign
Transcript: ENSMUST00000181321
Predicted Effect probably benign
Transcript: ENSMUST00000217976
Predicted Effect probably benign
Transcript: ENSMUST00000218750
Predicted Effect probably benign
Transcript: ENSMUST00000219867
Predicted Effect probably benign
Transcript: ENSMUST00000218970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219883
Meta Mutation Damage Score 0.1452 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in R3hdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02230:R3hdm4 APN 10 79912091 missense probably damaging 1.00
PIT4472001:R3hdm4 UTSW 10 79913555 critical splice donor site probably null
R0801:R3hdm4 UTSW 10 79913357 unclassified probably benign
R1167:R3hdm4 UTSW 10 79912073 critical splice donor site probably null
R3622:R3hdm4 UTSW 10 79912681 missense possibly damaging 0.96
R5264:R3hdm4 UTSW 10 79913341 missense probably benign 0.19
R5268:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5269:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5357:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5358:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5360:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5362:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5363:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5434:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5435:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5534:R3hdm4 UTSW 10 79912458 missense possibly damaging 0.69
R5921:R3hdm4 UTSW 10 79913619 missense probably damaging 1.00
R6041:R3hdm4 UTSW 10 79913661 missense possibly damaging 0.46
R7391:R3hdm4 UTSW 10 79911109 missense probably benign 0.00
R7496:R3hdm4 UTSW 10 79916874 missense probably damaging 0.99
R7913:R3hdm4 UTSW 10 79911945 missense probably damaging 1.00
R7983:R3hdm4 UTSW 10 79912723 missense probably damaging 1.00
X0022:R3hdm4 UTSW 10 79913652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATTCATTTCCACTGCCCAG -3'
(R):5'- CCGTTACTTGGAGGATGAGAGC -3'

Sequencing Primer
(F):5'- AGTCCTCTCCTTCCTAACCACTG -3'
(R):5'- CCAGGGCAAGCGGAGAC -3'
Posted On2016-09-01