Incidental Mutation 'R5442:Dyrk2'
ID427237
Institutional Source Beutler Lab
Gene Symbol Dyrk2
Ensembl Gene ENSMUSG00000028630
Gene Namedual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2
Synonyms1810038L18Rik
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location118855603-118870209 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118860738 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 205 (Q205R)
Ref Sequence ENSEMBL: ENSMUSP00000004281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004281]
Predicted Effect possibly damaging
Transcript: ENSMUST00000004281
AA Change: Q205R

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: Q205R

DomainStartEndE-ValueType
S_TKc 220 533 1.16e-92 SMART
low complexity region 560 574 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218692
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Dyrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dyrk2 APN 10 118859844 missense probably damaging 1.00
IGL00536:Dyrk2 APN 10 118860192 missense probably damaging 1.00
IGL01288:Dyrk2 APN 10 118860699 missense probably damaging 1.00
IGL01375:Dyrk2 APN 10 118860687 missense probably damaging 1.00
IGL01637:Dyrk2 APN 10 118860507 missense probably damaging 1.00
IGL02052:Dyrk2 APN 10 118860543 missense probably damaging 1.00
R0452:Dyrk2 UTSW 10 118868763 missense possibly damaging 0.91
R0833:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R0836:Dyrk2 UTSW 10 118861122 missense probably benign 0.00
R1346:Dyrk2 UTSW 10 118859719 missense possibly damaging 0.92
R1610:Dyrk2 UTSW 10 118859925 missense probably benign 0.02
R2397:Dyrk2 UTSW 10 118861368 intron probably benign
R2409:Dyrk2 UTSW 10 118860627 missense probably benign
R2965:Dyrk2 UTSW 10 118860337 nonsense probably null
R2966:Dyrk2 UTSW 10 118860337 nonsense probably null
R4700:Dyrk2 UTSW 10 118868286 missense probably benign
R4896:Dyrk2 UTSW 10 118868248 missense probably damaging 0.96
R4978:Dyrk2 UTSW 10 118860347 missense probably benign 0.00
R5393:Dyrk2 UTSW 10 118859848 missense probably damaging 0.98
R5496:Dyrk2 UTSW 10 118860051 missense probably damaging 1.00
R5810:Dyrk2 UTSW 10 118860340 missense probably benign 0.16
R5875:Dyrk2 UTSW 10 118860697 missense probably damaging 1.00
R5930:Dyrk2 UTSW 10 118860268 missense probably damaging 1.00
R6877:Dyrk2 UTSW 10 118860423 missense probably damaging 1.00
R7234:Dyrk2 UTSW 10 118860231 missense possibly damaging 0.84
R7442:Dyrk2 UTSW 10 118859881 missense probably damaging 1.00
R7741:Dyrk2 UTSW 10 118859689 missense probably benign
R8108:Dyrk2 UTSW 10 118859829 missense probably benign 0.27
R8137:Dyrk2 UTSW 10 118859884 missense probably benign 0.00
R8347:Dyrk2 UTSW 10 118859983 missense probably damaging 0.99
R8507:Dyrk2 UTSW 10 118860662 missense probably damaging 1.00
R8517:Dyrk2 UTSW 10 118861021 missense probably benign
R8695:Dyrk2 UTSW 10 118861017 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTGTTCCAAGATCCGGATC -3'
(R):5'- CTGAAGTCCATGGAAGGCATG -3'

Sequencing Primer
(F):5'- AAGATCCGGATCTCCTCGG -3'
(R):5'- GGGAAGGTAAAAGCCTCCCC -3'
Posted On2016-09-01