Incidental Mutation 'R5442:Olfr110'
ID427245
Institutional Source Beutler Lab
Gene Symbol Olfr110
Ensembl Gene ENSMUSG00000090894
Gene Nameolfactory receptor 110
SynonymsGA_x6K02T2PSCP-1956307-1957260, MOR249-2
MMRRC Submission 043007-MU
Accession Numbers

Genbank: NM_146328.2

Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37492468-37500207 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37499439 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 263 (I263F)
Ref Sequence ENSEMBL: ENSMUSP00000149213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168318] [ENSMUST00000216472]
Predicted Effect probably damaging
Transcript: ENSMUST00000168318
AA Change: I263F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131089
Gene: ENSMUSG00000090894
AA Change: I263F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.9e-54 PFAM
Pfam:7TM_GPCR_Srsx 35 286 1.9e-6 PFAM
Pfam:7tm_1 41 290 1.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216472
AA Change: I263F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Olfr110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01954:Olfr110 APN 17 37498649 utr 5 prime probably benign
IGL03088:Olfr110 APN 17 37498648 utr 5 prime probably benign
F5426:Olfr110 UTSW 17 37499536 missense probably damaging 1.00
R1664:Olfr110 UTSW 17 37499425 missense possibly damaging 0.83
R2883:Olfr110 UTSW 17 37499380 missense probably damaging 1.00
R4011:Olfr110 UTSW 17 37499491 missense possibly damaging 0.79
R4365:Olfr110 UTSW 17 37499379 missense probably damaging 1.00
R4989:Olfr110 UTSW 17 37499126 missense probably benign 0.10
R5577:Olfr110 UTSW 17 37499602 missense probably benign 0.02
R6592:Olfr110 UTSW 17 37499097 missense probably damaging 1.00
R7134:Olfr110 UTSW 17 37498885 missense probably damaging 1.00
R7840:Olfr110 UTSW 17 37498977 missense probably damaging 1.00
R8226:Olfr110 UTSW 17 37498669 missense probably benign 0.16
R8304:Olfr110 UTSW 17 37499370 missense probably damaging 1.00
R8310:Olfr110 UTSW 17 37499257 missense probably benign 0.00
R8435:Olfr110 UTSW 17 37498785 missense probably benign 0.01
R8779:Olfr110 UTSW 17 37498827 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCTGGACTCCTTTCCTG -3'
(R):5'- CCAGCAACAACTGAGTGGTAG -3'

Sequencing Primer
(F):5'- GGACTCCTTTCCTGTGCGTC -3'
(R):5'- GATTGTTGATCACACATAAGAGAGG -3'
Posted On2016-09-01