Incidental Mutation 'R5442:Pcdha2'
ID427246
Institutional Source Beutler Lab
Gene Symbol Pcdha2
Ensembl Gene ENSMUSG00000104148
Gene Nameprotocadherin alpha 2
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location36939205-37187657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36939862 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 182 (V182A)
Ref Sequence ENSEMBL: ENSMUSP00000141355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070797] [ENSMUST00000115662] [ENSMUST00000193839] [ENSMUST00000195590]
Predicted Effect probably benign
Transcript: ENSMUST00000070797
SMART Domains Protein: ENSMUSP00000068828
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Pfam:Cadherin_tail 797 931 5.3e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115662
AA Change: V182A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000111326
Gene: ENSMUSG00000104148
AA Change: V182A

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
low complexity region 916 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192440
Predicted Effect probably benign
Transcript: ENSMUST00000193839
SMART Domains Protein: ENSMUSP00000142308
Gene: ENSMUSG00000103442

DomainStartEndE-ValueType
CA 22 132 3.09e-2 SMART
CA 156 241 6.14e-20 SMART
CA 265 349 3.92e-27 SMART
CA 373 454 4.94e-24 SMART
CA 478 564 1e-24 SMART
CA 592 672 4.55e-14 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195590
AA Change: V182A

PolyPhen 2 Score 0.144 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141355
Gene: ENSMUSG00000104148
AA Change: V182A

DomainStartEndE-ValueType
CA 45 131 6.34e-2 SMART
CA 155 240 2.98e-18 SMART
CA 264 348 2.17e-29 SMART
CA 372 453 2.84e-24 SMART
CA 477 563 5.02e-25 SMART
CA 594 675 8.16e-16 SMART
transmembrane domain 695 717 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin alpha gene cluster, one of three related gene clusters tandemly linked on chromosome five that demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The alpha gene cluster is composed of 15 cadherin superfamily genes related to the mouse CNR genes and consists of 13 highly similar and 2 more distantly related coding sequences. The tandem array of 15 N-terminal exons, or variable exons, are followed by downstream C-terminal exons, or constant exons, which are shared by all genes in the cluster. The large, uninterrupted N-terminal exons each encode six cadherin ectodomains while the C-terminal exons encode the cytoplasmic domain. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins that most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been observed and additional variants have been suggested but their full-length nature has yet to be determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Pcdha2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03052:Pcdha2 UTSW 18 36941617 missense probably damaging 1.00
R3157:Pcdha2 UTSW 18 36940092 missense probably damaging 1.00
R3159:Pcdha2 UTSW 18 36941197 missense probably damaging 1.00
R3806:Pcdha2 UTSW 18 36939529 missense probably benign 0.02
R3806:Pcdha2 UTSW 18 36941691 nonsense probably null
R3815:Pcdha2 UTSW 18 36941695 missense probably benign
R3816:Pcdha2 UTSW 18 36941695 missense probably benign
R3937:Pcdha2 UTSW 18 36941323 missense probably benign 0.42
R3970:Pcdha2 UTSW 18 36940697 nonsense probably null
R4058:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4059:Pcdha2 UTSW 18 36939882 missense probably benign 0.07
R4179:Pcdha2 UTSW 18 36941476 missense probably damaging 1.00
R4457:Pcdha2 UTSW 18 36940546 missense probably damaging 1.00
R4724:Pcdha2 UTSW 18 36940515 missense possibly damaging 0.88
R4812:Pcdha2 UTSW 18 36939808 missense probably benign
R4884:Pcdha2 UTSW 18 36940900 missense probably damaging 1.00
R5130:Pcdha2 UTSW 18 36940669 missense probably damaging 1.00
R5223:Pcdha2 UTSW 18 36940791 missense probably damaging 1.00
R5460:Pcdha2 UTSW 18 36939421 missense probably damaging 1.00
R5493:Pcdha2 UTSW 18 36939509 missense probably damaging 0.98
R5946:Pcdha2 UTSW 18 36941106 missense probably damaging 0.96
R6054:Pcdha2 UTSW 18 36940804 missense probably damaging 1.00
R7378:Pcdha2 UTSW 18 36939385 missense possibly damaging 0.88
R7465:Pcdha2 UTSW 18 36940330 missense probably damaging 1.00
R7542:Pcdha2 UTSW 18 36940089 missense probably damaging 0.99
R7774:Pcdha2 UTSW 18 36941526 missense probably benign
R7953:Pcdha2 UTSW 18 36939526 missense probably benign 0.00
R8043:Pcdha2 UTSW 18 36939526 missense probably benign 0.00
R8048:Pcdha2 UTSW 18 36939460 missense probably damaging 1.00
R8371:Pcdha2 UTSW 18 36940263 missense possibly damaging 0.84
R8414:Pcdha2 UTSW 18 36941566 missense probably damaging 1.00
R8472:Pcdha2 UTSW 18 36941272 missense probably damaging 1.00
Z1088:Pcdha2 UTSW 18 36941121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACATTAACGACAACCCG -3'
(R):5'- CTAAGGTTCCGTTTGCAGTG -3'

Sequencing Primer
(F):5'- GCCGCGATTTCCAATGACAG -3'
(R):5'- GCAGTGTTCTCTAACAACTGTAC -3'
Posted On2016-09-01