Incidental Mutation 'R5442:Ablim3'
ID427247
Institutional Source Beutler Lab
Gene Symbol Ablim3
Ensembl Gene ENSMUSG00000032735
Gene Nameactin binding LIM protein family, member 3
SynonymsD930036B08Rik
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61799395-61911852 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 61857225 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049378] [ENSMUST00000166783]
Predicted Effect probably null
Transcript: ENSMUST00000049378
SMART Domains Protein: ENSMUSP00000041243
Gene: ENSMUSG00000032735

DomainStartEndE-ValueType
LIM 22 73 4.19e-8 SMART
LIM 81 133 2.31e-10 SMART
LIM 150 201 2.4e-17 SMART
LIM 209 261 1.12e-8 SMART
Pfam:AbLIM_anchor 273 646 6.5e-154 PFAM
VHP 647 682 1.66e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166783
SMART Domains Protein: ENSMUSP00000125836
Gene: ENSMUSG00000032735

DomainStartEndE-ValueType
LIM 22 73 4.19e-8 SMART
LIM 81 133 2.31e-10 SMART
LIM 150 201 2.4e-17 SMART
LIM 209 261 1.12e-8 SMART
Pfam:AbLIM_anchor 273 646 6.5e-154 PFAM
VHP 647 682 1.66e-19 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the actin-binding LIM (abLIM) family of proteins. These proteins are characterized by an N-terminal LIM domain and a C-terminal dematin-like domain. The encoded protein interacts with actin filaments and may be a component of adherens junctions in several cell types. A variant of this gene may be associated with pain sensitivity in male human patients. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Gm14085 A G 2: 122,486,869 N36S probably benign Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Ablim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ablim3 APN 18 61849406 missense possibly damaging 0.83
IGL00954:Ablim3 APN 18 61839685 splice site probably benign
IGL01012:Ablim3 APN 18 61839701 missense possibly damaging 0.91
IGL01402:Ablim3 APN 18 61871683 missense probably damaging 0.99
IGL01404:Ablim3 APN 18 61871683 missense probably damaging 0.99
IGL01609:Ablim3 APN 18 61822021 missense probably benign 0.05
IGL01710:Ablim3 APN 18 61871574 missense probably damaging 1.00
IGL01775:Ablim3 APN 18 61816918 splice site probably benign
IGL02967:Ablim3 APN 18 61826503 nonsense probably null
IGL03409:Ablim3 APN 18 61845851 missense probably damaging 1.00
R0143:Ablim3 UTSW 18 61855217 missense probably benign 0.20
R0601:Ablim3 UTSW 18 61849370 missense probably benign 0.19
R1067:Ablim3 UTSW 18 61823947 splice site probably benign
R1642:Ablim3 UTSW 18 61814311 missense probably benign 0.26
R1851:Ablim3 UTSW 18 61849395 missense probably benign 0.33
R1852:Ablim3 UTSW 18 61849395 missense probably benign 0.33
R2072:Ablim3 UTSW 18 61857088 missense possibly damaging 0.74
R2763:Ablim3 UTSW 18 61813544 nonsense probably null
R4865:Ablim3 UTSW 18 61805086 missense probably damaging 1.00
R5190:Ablim3 UTSW 18 61819911 missense probably benign 0.00
R5353:Ablim3 UTSW 18 61801399 missense probably damaging 1.00
R5835:Ablim3 UTSW 18 61823922 missense probably damaging 1.00
R6547:Ablim3 UTSW 18 61823929 missense probably benign 0.01
R7231:Ablim3 UTSW 18 61805064 critical splice donor site probably null
R7386:Ablim3 UTSW 18 61821994 missense probably damaging 1.00
R7404:Ablim3 UTSW 18 61822028 missense probably damaging 0.99
R7529:Ablim3 UTSW 18 61821968 missense probably benign
X0028:Ablim3 UTSW 18 61805112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAGCTGCATACGAAGC -3'
(R):5'- GGACTCAGGGATTCCAAACCAAG -3'

Sequencing Primer
(F):5'- CAAGCTGCATACGAAGCATTTAG -3'
(R):5'- TCAGGGATTCCAAACCAAGCTTAGG -3'
Posted On2016-09-01