Incidental Mutation 'R5443:Sept2'
ID427253
Institutional Source Beutler Lab
Gene Symbol Sept2
Ensembl Gene ENSMUSG00000026276
Gene Nameseptin 2
SynonymsNedd5
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93478964-93510260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93497452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 110 (N110S)
Ref Sequence ENSEMBL: ENSMUSP00000115536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027495] [ENSMUST00000112912] [ENSMUST00000129211] [ENSMUST00000131175] [ENSMUST00000136182] [ENSMUST00000142401] [ENSMUST00000149532] [ENSMUST00000150931] [ENSMUST00000153826] [ENSMUST00000168776] [ENSMUST00000172165] [ENSMUST00000179353]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027495
AA Change: N110S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027495
Gene: ENSMUSG00000026276
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112912
AA Change: N110S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000108534
Gene: ENSMUSG00000026276
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129211
AA Change: N110S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120511
Gene: ENSMUSG00000026276
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 213 4.9e-85 PFAM
Pfam:AIG1 38 131 9.9e-7 PFAM
Pfam:MMR_HSR1 39 211 1.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131175
AA Change: N110S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120694
Gene: ENSMUSG00000026276
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 212 6.5e-85 PFAM
Pfam:AIG1 38 131 9.8e-7 PFAM
Pfam:MMR_HSR1 39 211 1.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136182
AA Change: N70S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118621
Gene: ENSMUSG00000026276
AA Change: N70S

DomainStartEndE-ValueType
Pfam:AIG1 1 96 1.4e-6 PFAM
Pfam:MMR_HSR1 1 103 1.3e-8 PFAM
Pfam:Septin 1 107 6.4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142401
AA Change: N140S

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121974
Gene: ENSMUSG00000026276
AA Change: N140S

DomainStartEndE-ValueType
Pfam:Septin 64 177 4.9e-49 PFAM
Pfam:AIG1 68 159 2.3e-7 PFAM
Pfam:MMR_HSR1 69 172 1.1e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149532
AA Change: N110S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115536
Gene: ENSMUSG00000026276
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 120 7e-35 PFAM
Pfam:GTP_EFTU 37 110 9.5e-6 PFAM
Pfam:AIG1 38 120 3.4e-7 PFAM
Pfam:Ras 39 115 1.2e-5 PFAM
Pfam:MMR_HSR1 39 118 2.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150931
AA Change: N110S

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000117517
Gene: ENSMUSG00000026276
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 221 4.8e-87 PFAM
Pfam:AIG1 38 130 1.1e-6 PFAM
Pfam:MMR_HSR1 39 213 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152778
Predicted Effect probably benign
Transcript: ENSMUST00000153826
SMART Domains Protein: ENSMUSP00000114614
Gene: ENSMUSG00000026276

DomainStartEndE-ValueType
Pfam:Septin 34 77 4.7e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168776
AA Change: N110S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132850
Gene: ENSMUSG00000116048
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.4e-129 PFAM
Pfam:MMR_HSR1 39 240 1.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172165
AA Change: N70S

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127276
Gene: ENSMUSG00000116048
AA Change: N70S

DomainStartEndE-ValueType
Pfam:MMR_HSR1 1 203 5.8e-8 PFAM
Pfam:Septin 1 273 1.5e-125 PFAM
coiled coil region 277 308 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000179353
AA Change: N110S

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136366
Gene: ENSMUSG00000116048
AA Change: N110S

DomainStartEndE-ValueType
Pfam:Septin 34 313 1.1e-129 PFAM
Pfam:MMR_HSR1 39 242 3.2e-8 PFAM
low complexity region 330 348 N/A INTRINSIC
Meta Mutation Damage Score 0.6518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Sept2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Sept2 APN 1 93499142 missense probably damaging 1.00
IGL01909:Sept2 APN 1 93499101 missense probably damaging 1.00
IGL02504:Sept2 APN 1 93500481 missense probably benign 0.06
R0136:Sept2 UTSW 1 93507050 missense possibly damaging 0.57
R0140:Sept2 UTSW 1 93501639 missense probably damaging 1.00
R0335:Sept2 UTSW 1 93495599 missense probably damaging 1.00
R0538:Sept2 UTSW 1 93501623 missense probably damaging 1.00
R1370:Sept2 UTSW 1 93499106 missense probably damaging 1.00
R1463:Sept2 UTSW 1 93499315 missense possibly damaging 0.79
R4832:Sept2 UTSW 1 93499127 missense probably damaging 0.98
R5845:Sept2 UTSW 1 93499035 splice site probably null
R5898:Sept2 UTSW 1 93479301 missense probably benign
R6122:Sept2 UTSW 1 93497376 missense probably damaging 1.00
R6542:Sept2 UTSW 1 93497466 critical splice donor site probably null
R7784:Sept2 UTSW 1 93497444 missense probably damaging 1.00
R8074:Sept2 UTSW 1 93505561 missense probably benign
R8266:Sept2 UTSW 1 93501526 missense possibly damaging 0.91
R8277:Sept2 UTSW 1 93499308 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATGGATATCTCTCCTTCTAGCATGC -3'
(R):5'- GGCTGCAGTCTGTATTACAGTG -3'

Sequencing Primer
(F):5'- GCATGCTGCCTTGATTTTTAAGTAC -3'
(R):5'- ATTCTGAGTTCAAGGCCAGC -3'
Posted On2016-09-01