Mutagenetix > Incidental Mutation

Incidental Mutation 'R5443:Zer1'

427255

Institutional Source

Beutler Lab

Gene Symbol

Zer1

Ensembl Gene

ENSMUSG00000039686

Gene Name

zyg-11 related, cell cycle regulator

Synonyms

C230075L19Rik, Zyg11bl

MMRRC Submission

043008-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R5443 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

30097283-30124585 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30110996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 138 (G138S)

Ref Sequence

ENSEMBL: ENSMUSP00000109307 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]

AlphaFold

Q80ZJ6

Predicted Effect

probably damaging
Transcript: ENSMUST00000044751
AA Change: G138S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: G138S

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	405	774	3e-15	SMART
Blast:ARM	440	480	2e-18	BLAST
Blast:ARM	524	569	4e-24	BLAST
Blast:ARM	571	613	6e-22	BLAST
Blast:ARM	617	656	7e-8	BLAST
Blast:ARM	686	724	6e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000113677
AA Change: G138S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: G138S

Domain	Start	End	E-Value	Type
SCOP:d1jdha_	392	761	3e-15	SMART
Blast:ARM	427	467	2e-18	BLAST
Blast:ARM	511	556	4e-24	BLAST
Blast:ARM	558	600	2e-21	BLAST
Blast:ARM	604	643	7e-8	BLAST
Blast:ARM	673	711	6e-18	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131858

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133354

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139128

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154231

Meta Mutation Damage Score

0.2168

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	G	T	16: 90,927,211	Q168K	probably benign	Het
Akap12	A	T	10: 4,355,576	E795D	probably damaging	Het
Aldh6a1	T	C	12: 84,437,971		probably null	Het
Aox4	A	G	1: 58,233,992		probably null	Het
Arhgap39	G	A	15: 76,797,925		probably benign	Het
AW551984	T	C	9: 39,598,029	E272G	possibly damaging	Het
C1qc	G	A	4: 136,892,493		probably benign	Het
Carhsp1	C	A	16: 8,664,339	R26L	probably benign	Het
Cdh12	G	T	15: 21,237,849	V57L	probably benign	Het
Clec3a	A	G	8: 114,418,153	Y23C	probably benign	Het
Crebrf	G	C	17: 26,742,354	V150L	probably damaging	Het
Ddx41	G	T	13: 55,535,291	A201E	probably benign	Het
Doc2b	T	C	11: 75,780,095	K237E	probably damaging	Het
Dst	T	C	1: 34,228,539	S5199P	probably damaging	Het
Efnb2	A	G	8: 8,620,862	I129T	probably damaging	Het
Epg5	A	G	18: 78,027,497	E2329G	possibly damaging	Het
Esrrg	A	C	1: 188,043,425	T27P	possibly damaging	Het
Fah	T	A	7: 84,592,396	R316W	probably damaging	Het
Fat4	T	C	3: 39,010,370	L4825P	probably damaging	Het
Gabbr1	T	C	17: 37,070,756	V804A	probably damaging	Het
Gm1322	G	A	2: 67,184,668		noncoding transcript	Het
Gm5114	T	A	7: 39,408,865	K443N	probably benign	Het
Gnai2	T	C	9: 107,620,187	I3V	probably damaging	Het
Gp2	G	A	7: 119,454,598	P47S	possibly damaging	Het
I830127L07Rik	A	T	15: 75,133,719		noncoding transcript	Het
Klf15	C	A	6: 90,467,360	Q306K	possibly damaging	Het
Necab2	A	T	8: 119,468,293	M295L	probably benign	Het
Nrg1	A	T	8: 31,849,320	Y208N	probably damaging	Het
Nup88	A	T	11: 70,958,430	Y232*	probably null	Het
Oacyl	A	G	18: 65,750,182	R611G	probably benign	Het
Oasl1	T	C	5: 114,936,070		probably null	Het
Olfr1061	A	C	2: 86,413,593	I153R	possibly damaging	Het
Olfr138	T	A	17: 38,275,014	M81K	probably damaging	Het
Olfr1384	G	T	11: 49,514,435	G266C	probably damaging	Het
Olfr652	T	C	7: 104,564,376	Y52H	probably benign	Het
Pate4	A	C	9: 35,607,874	S66A	possibly damaging	Het
Pigl	T	A	11: 62,458,483	C8*	probably null	Het
Plg	G	A	17: 12,382,183	A51T	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppig	A	T	2: 69,734,291	D97V	probably damaging	Het
Ppp1r16a	A	G	15: 76,694,646	K517E	possibly damaging	Het
Prr16	A	T	18: 51,303,153	S235C	probably damaging	Het
Psmd1	G	A	1: 86,090,183	R572H	probably damaging	Het
Sbf2	T	C	7: 110,377,928		probably benign	Het
Scrt2	A	T	2: 152,082,123	Y25F	probably benign	Het
Sema6d	A	T	2: 124,656,836	H222L	probably damaging	Het
Sept2	A	G	1: 93,497,452	N110S	possibly damaging	Het
Shpk	G	A	11: 73,222,781	G340D	possibly damaging	Het
Smg5	T	A	3: 88,354,589	L723H	probably damaging	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Spo11	T	C	2: 172,989,359		probably benign	Het
Srarp	T	A	4: 141,436,077		probably null	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tm9sf2	A	T	14: 122,126,195	Y109F	probably damaging	Het
Tmem57	A	T	4: 134,833,308	C121*	probably null	Het
Tpcn2	A	T	7: 145,255,472	M699K	possibly damaging	Het
Trim34a	T	C	7: 104,260,213	F289S	possibly damaging	Het
Trim39	T	C	17: 36,260,753	H371R	probably damaging	Het
Usp48	T	A	4: 137,621,221	I11N	possibly damaging	Het
Zbtb10	T	C	3: 9,280,048	F677L	probably benign	Het
Zfp612	A	G	8: 110,089,595	K439R	possibly damaging	Het

Other mutations in Zer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01098:Zer1	APN	2	30108220	critical splice donor site	probably null
IGL01630:Zer1	APN	2	30101831	missense	probably damaging	1.00
IGL02126:Zer1	APN	2	30104916	missense	probably benign	0.10
IGL02338:Zer1	APN	2	30113393	missense	probably damaging	1.00
IGL02817:Zer1	APN	2	30103394	missense	probably damaging	0.99
PIT4402001:Zer1	UTSW	2	30101120	missense	probably damaging	0.96
PIT4495001:Zer1	UTSW	2	30103543	missense	probably benign	0.01
R0390:Zer1	UTSW	2	30108213	splice site	probably benign
R0506:Zer1	UTSW	2	30101807	missense	probably damaging	1.00
R0606:Zer1	UTSW	2	30104797	splice site	probably benign
R0928:Zer1	UTSW	2	30101763	critical splice donor site	probably null
R1167:Zer1	UTSW	2	30108246	missense	probably benign	0.00
R1819:Zer1	UTSW	2	30110218	missense	probably benign	0.18
R2040:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2041:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2042:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2092:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2168:Zer1	UTSW	2	30104875	missense	probably damaging	1.00
R2243:Zer1	UTSW	2	30101127	missense	probably damaging	0.99
R2254:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2255:Zer1	UTSW	2	30108274	missense	probably damaging	1.00
R2311:Zer1	UTSW	2	30101822	missense	probably damaging	0.99
R2993:Zer1	UTSW	2	30101897	missense	probably damaging	1.00
R3010:Zer1	UTSW	2	30113285	missense	probably benign	0.13
R3731:Zer1	UTSW	2	30110911	missense	probably benign	0.44
R4038:Zer1	UTSW	2	30107523	missense	probably damaging	1.00
R5241:Zer1	UTSW	2	30104970	missense	probably damaging	1.00
R5433:Zer1	UTSW	2	30100986	intron	probably benign
R5524:Zer1	UTSW	2	30104854	missense	probably damaging	1.00
R5936:Zer1	UTSW	2	30107667	missense	probably damaging	0.97
R5999:Zer1	UTSW	2	30104997	missense	probably damaging	1.00
R6598:Zer1	UTSW	2	30113274	missense	probably damaging	1.00
R6965:Zer1	UTSW	2	30101047	missense	possibly damaging	0.87
R7030:Zer1	UTSW	2	30111021	missense	probably benign	0.00
R7190:Zer1	UTSW	2	30103432	missense	probably damaging	1.00
R7218:Zer1	UTSW	2	30105012	missense	probably damaging	1.00
R7252:Zer1	UTSW	2	30101892	missense	probably damaging	0.99
R7383:Zer1	UTSW	2	30111241	missense	probably damaging	1.00
R7417:Zer1	UTSW	2	30102822	missense	probably damaging	1.00
R7459:Zer1	UTSW	2	30113325	missense	probably damaging	1.00
R7463:Zer1	UTSW	2	30113437	start gained	probably benign
R7466:Zer1	UTSW	2	30101484	splice site	probably null
R7477:Zer1	UTSW	2	30107976	missense	probably null	0.34
R7719:Zer1	UTSW	2	30111231	missense	probably damaging	1.00
R7813:Zer1	UTSW	2	30110373	missense	probably damaging	1.00
R7976:Zer1	UTSW	2	30107508	missense	probably damaging	0.99
R8239:Zer1	UTSW	2	30101135	critical splice acceptor site	probably null
R8350:Zer1	UTSW	2	30101850	missense	probably damaging	1.00
R8404:Zer1	UTSW	2	30105023	critical splice acceptor site	probably null
R8842:Zer1	UTSW	2	30111050	missense	possibly damaging	0.65
R8896:Zer1	UTSW	2	30103418	missense	probably damaging	0.99
R8906:Zer1	UTSW	2	30111023	missense	probably benign	0.31
R8929:Zer1	UTSW	2	30110869	missense	probably damaging	1.00
R9050:Zer1	UTSW	2	30111282	missense	probably damaging	1.00
R9066:Zer1	UTSW	2	30110674	missense	probably damaging	1.00
R9277:Zer1	UTSW	2	30111285	missense	probably benign	0.00
R9322:Zer1	UTSW	2	30110911	missense	probably benign	0.00
R9577:Zer1	UTSW	2	30101038	missense	probably damaging	1.00
R9733:Zer1	UTSW	2	30107631	missense	probably benign	0.00
X0026:Zer1	UTSW	2	30104895	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTTGTCTGGATGCCTGAGAG -3'
(R):5'- TTCGCAAACAGGTGAGACC -3'

Sequencing Primer
(F):5'- CTGGATGCCTGAGAGGTCCAAG -3'
(R):5'- AACAGGTGAGACCCTGCC -3'

Posted On

2016-09-01