Incidental Mutation 'R5443:Olfr1061'
ID427257
Institutional Source Beutler Lab
Gene Symbol Olfr1061
Ensembl Gene ENSMUSG00000075185
Gene Nameolfactory receptor 1061
SynonymsMOR188-9, MOR188-1, MOR188-7, Olfr1515, GA_x6K02T2Q125-47883395-47882454, MOR188-1
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86413109-86414050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86413593 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Arginine at position 153 (I153R)
Ref Sequence ENSEMBL: ENSMUSP00000097474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099889]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099889
AA Change: I153R

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097474
Gene: ENSMUSG00000075185
AA Change: I153R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-51 PFAM
Pfam:7tm_1 41 291 2.2e-17 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Olfr1061
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Olfr1061 APN 2 86413800 missense probably benign 0.35
IGL01721:Olfr1061 APN 2 86413333 missense probably damaging 1.00
IGL02696:Olfr1061 APN 2 86413615 missense probably benign 0.03
BB007:Olfr1061 UTSW 2 86413216 missense probably damaging 1.00
BB017:Olfr1061 UTSW 2 86413216 missense probably damaging 1.00
R0366:Olfr1061 UTSW 2 86414025 missense possibly damaging 0.71
R0607:Olfr1061 UTSW 2 86413170 missense probably damaging 1.00
R1013:Olfr1061 UTSW 2 86413975 missense possibly damaging 0.61
R1017:Olfr1061 UTSW 2 86413511 missense probably damaging 1.00
R1617:Olfr1061 UTSW 2 86413691 nonsense probably null
R1690:Olfr1061 UTSW 2 86413954 missense probably benign 0.03
R4126:Olfr1061 UTSW 2 86413224 missense probably damaging 0.99
R5053:Olfr1061 UTSW 2 86413338 missense probably damaging 1.00
R6195:Olfr1061 UTSW 2 86413207 missense probably damaging 0.98
R6233:Olfr1061 UTSW 2 86413207 missense probably damaging 0.98
R6468:Olfr1061 UTSW 2 86414037 missense probably damaging 0.99
R7188:Olfr1061 UTSW 2 86413351 nonsense probably null
R7300:Olfr1061 UTSW 2 86413986 missense probably null 0.27
R7374:Olfr1061 UTSW 2 86413852 missense probably benign 0.39
R7392:Olfr1061 UTSW 2 86413152 missense probably benign
R7494:Olfr1061 UTSW 2 86413248 missense probably benign 0.24
R7930:Olfr1061 UTSW 2 86413216 missense probably damaging 1.00
X0023:Olfr1061 UTSW 2 86413959 missense probably benign 0.29
Z1176:Olfr1061 UTSW 2 86413528 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAGAAAGCCTTCCATTTGCCC -3'
(R):5'- ATGCCTGTGCTATCCAATCATC -3'

Sequencing Primer
(F):5'- GCCCTCAGCAGAGTTAATCCTTAG -3'
(R):5'- GTGCTATCCAATCATCTTTCTTTGG -3'
Posted On2016-09-01