Incidental Mutation 'R5443:Spo11'
ID427260
Institutional Source Beutler Lab
Gene Symbol Spo11
Ensembl Gene ENSMUSG00000005883
Gene NameSPO11 meiotic protein covalently bound to DSB
Synonyms
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location172977700-172993576 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 172989359 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000104754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050442] [ENSMUST00000109125] [ENSMUST00000109126]
Predicted Effect probably benign
Transcript: ENSMUST00000050442
SMART Domains Protein: ENSMUSP00000059056
Gene: ENSMUSG00000005883

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 6.3e-28 PFAM
Pfam:TP6A_N 107 170 3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109125
SMART Domains Protein: ENSMUSP00000104753
Gene: ENSMUSG00000005883

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1e-30 PFAM
Pfam:TP6A_N 66 133 3.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109126
SMART Domains Protein: ENSMUSP00000104754
Gene: ENSMUSG00000005883

DomainStartEndE-ValueType
Pfam:SPO11_like 2 44 1.1e-30 PFAM
Pfam:TP6A_N 102 146 1.9e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156471
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meiotic recombination and chromosome segregation require the formation of double-strand breaks (DSBs) in paired chromosome homologs. During meiosis in yeast, a meiotic recombination protein is covalently-linked to the 5' end of DSBs and is essential for the formation of DSBs. The protein encoded by this gene is similar in sequence and conserved features to the yeast meiotic recombination protein. The encoded protein belongs to the TOP6A protein family. Several transcript variants encoding different isoforms have been found for this gene, but the full-length nature of only two of them have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation are sterile. Mutant males exhibit loss of spermatocytes in early prophase, while mutant females exhibit oocyte loss soon after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Spo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Spo11 APN 2 172989032 critical splice donor site probably null
IGL02080:Spo11 APN 2 172989395 missense probably damaging 1.00
IGL02309:Spo11 APN 2 172979951 missense probably damaging 0.98
R3027:Spo11 UTSW 2 172985943 missense probably damaging 0.99
R4031:Spo11 UTSW 2 172986832 splice site probably benign
R5000:Spo11 UTSW 2 172989400 missense probably damaging 1.00
R7185:Spo11 UTSW 2 172982192 splice site probably null
R7486:Spo11 UTSW 2 172984077 missense probably benign 0.01
R7565:Spo11 UTSW 2 172992071 missense possibly damaging 0.65
R7958:Spo11 UTSW 2 172984022 missense probably benign 0.00
R8120:Spo11 UTSW 2 172985458 missense probably damaging 0.98
X0061:Spo11 UTSW 2 172993050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATTTGCATAGTACACTGTG -3'
(R):5'- GAGATCACCATCTCCCTAGGAC -3'

Sequencing Primer
(F):5'- CATGCATGACGTCCTAGGTTCAATG -3'
(R):5'- CTAGGACATTCTGGAAAGCCCTG -3'
Posted On2016-09-01