Mutagenetix > Incidental Mutations

Incidental Mutation 'R5443:Oasl1'

427268

Institutional Source

Beutler Lab

Gene Symbol

Oasl1

Ensembl Gene

ENSMUSG00000041827

Gene Name

2'-5' oligoadenylate synthetase-like 1

Synonyms

MMRRC Submission

043008-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5443 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114923240-114937915 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 114936070 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107771 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031540] [ENSMUST00000112143]

AlphaFold

Q8VI94

Predicted Effect

probably null
Transcript: ENSMUST00000031540

SMART Domains

Protein: ENSMUSP00000031540
Gene: ENSMUSG00000041827

Domain	Start	End	E-Value	Type
low complexity region	31	42	N/A	INTRINSIC
Pfam:OAS1_C	162	348	8e-76	PFAM
UBQ	350	425	1.58e0	SMART
UBQ	430	501	2.22e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112143

SMART Domains

Protein: ENSMUSP00000107771
Gene: ENSMUSG00000041827

Domain	Start	End	E-Value	Type
low complexity region	31	42	N/A	INTRINSIC
Pfam:OAS1_C	163	346	1.9e-79	PFAM
UBQ	350	425	1.58e0	SMART
UBQ	430	501	2.22e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140159

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155274

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155394

Meta Mutation Damage Score

0.9487

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

PHENOTYPE: Mice with a deletion of this gene have increased expression of type I interferon and show increased resistance to viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	G	T	16: 90,927,211	Q168K	probably benign	Het
Akap12	A	T	10: 4,355,576	E795D	probably damaging	Het
Aldh6a1	T	C	12: 84,437,971		probably null	Het
Aox4	A	G	1: 58,233,992		probably null	Het
Arhgap39	G	A	15: 76,797,925		probably benign	Het
AW551984	T	C	9: 39,598,029	E272G	possibly damaging	Het
C1qc	G	A	4: 136,892,493		probably benign	Het
Carhsp1	C	A	16: 8,664,339	R26L	probably benign	Het
Cdh12	G	T	15: 21,237,849	V57L	probably benign	Het
Clec3a	A	G	8: 114,418,153	Y23C	probably benign	Het
Crebrf	G	C	17: 26,742,354	V150L	probably damaging	Het
Ddx41	G	T	13: 55,535,291	A201E	probably benign	Het
Doc2b	T	C	11: 75,780,095	K237E	probably damaging	Het
Dst	T	C	1: 34,228,539	S5199P	probably damaging	Het
Efnb2	A	G	8: 8,620,862	I129T	probably damaging	Het
Epg5	A	G	18: 78,027,497	E2329G	possibly damaging	Het
Esrrg	A	C	1: 188,043,425	T27P	possibly damaging	Het
Fah	T	A	7: 84,592,396	R316W	probably damaging	Het
Fat4	T	C	3: 39,010,370	L4825P	probably damaging	Het
Gabbr1	T	C	17: 37,070,756	V804A	probably damaging	Het
Gm1322	G	A	2: 67,184,668		noncoding transcript	Het
Gm5114	T	A	7: 39,408,865	K443N	probably benign	Het
Gnai2	T	C	9: 107,620,187	I3V	probably damaging	Het
Gp2	G	A	7: 119,454,598	P47S	possibly damaging	Het
I830127L07Rik	A	T	15: 75,133,719		noncoding transcript	Het
Klf15	C	A	6: 90,467,360	Q306K	possibly damaging	Het
Necab2	A	T	8: 119,468,293	M295L	probably benign	Het
Nrg1	A	T	8: 31,849,320	Y208N	probably damaging	Het
Nup88	A	T	11: 70,958,430	Y232*	probably null	Het
Oacyl	A	G	18: 65,750,182	R611G	probably benign	Het
Olfr1061	A	C	2: 86,413,593	I153R	possibly damaging	Het
Olfr138	T	A	17: 38,275,014	M81K	probably damaging	Het
Olfr1384	G	T	11: 49,514,435	G266C	probably damaging	Het
Olfr652	T	C	7: 104,564,376	Y52H	probably benign	Het
Pate4	A	C	9: 35,607,874	S66A	possibly damaging	Het
Pigl	T	A	11: 62,458,483	C8*	probably null	Het
Plg	G	A	17: 12,382,183	A51T	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppig	A	T	2: 69,734,291	D97V	probably damaging	Het
Ppp1r16a	A	G	15: 76,694,646	K517E	possibly damaging	Het
Prr16	A	T	18: 51,303,153	S235C	probably damaging	Het
Psmd1	G	A	1: 86,090,183	R572H	probably damaging	Het
Sbf2	T	C	7: 110,377,928		probably benign	Het
Scrt2	A	T	2: 152,082,123	Y25F	probably benign	Het
Sema6d	A	T	2: 124,656,836	H222L	probably damaging	Het
Sept2	A	G	1: 93,497,452	N110S	possibly damaging	Het
Shpk	G	A	11: 73,222,781	G340D	possibly damaging	Het
Smg5	T	A	3: 88,354,589	L723H	probably damaging	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Spo11	T	C	2: 172,989,359		probably benign	Het
Srarp	T	A	4: 141,436,077		probably null	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tm9sf2	A	T	14: 122,126,195	Y109F	probably damaging	Het
Tmem57	A	T	4: 134,833,308	C121*	probably null	Het
Tpcn2	A	T	7: 145,255,472	M699K	possibly damaging	Het
Trim34a	T	C	7: 104,260,213	F289S	possibly damaging	Het
Trim39	T	C	17: 36,260,753	H371R	probably damaging	Het
Usp48	T	A	4: 137,621,221	I11N	possibly damaging	Het
Zbtb10	T	C	3: 9,280,048	F677L	probably benign	Het
Zer1	C	T	2: 30,110,996	G138S	probably damaging	Het
Zfp612	A	G	8: 110,089,595	K439R	possibly damaging	Het

Other mutations in Oasl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Oasl1	APN	5	114937407	missense	probably benign	0.01
IGL02061:Oasl1	APN	5	114923592	missense	probably damaging	0.97
IGL02888:Oasl1	APN	5	114937182	missense	probably damaging	1.00
IGL03230:Oasl1	APN	5	114937056	missense	probably damaging	1.00
ammonite	UTSW	5	114936937	missense	probably damaging	1.00
dreadnaught	UTSW	5	114936070	critical splice donor site	probably null
nautilus	UTSW	5	114937183	missense	probably damaging	1.00
spirogyra	UTSW	5	114937406	missense	probably benign	0.00
IGL03048:Oasl1	UTSW	5	114937341	missense	possibly damaging	0.56
R1510:Oasl1	UTSW	5	114928108	missense	probably benign	0.00
R1680:Oasl1	UTSW	5	114935944	missense	probably damaging	1.00
R1918:Oasl1	UTSW	5	114923469	missense	possibly damaging	0.84
R2090:Oasl1	UTSW	5	114935934	missense	probably damaging	1.00
R3977:Oasl1	UTSW	5	114932898	missense	probably damaging	1.00
R3978:Oasl1	UTSW	5	114932898	missense	probably damaging	1.00
R3980:Oasl1	UTSW	5	114932898	missense	probably damaging	1.00
R4158:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4159:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4160:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4161:Oasl1	UTSW	5	114937014	missense	possibly damaging	0.77
R4797:Oasl1	UTSW	5	114928158	missense	probably benign	0.00
R5354:Oasl1	UTSW	5	114936996	missense	probably damaging	1.00
R5820:Oasl1	UTSW	5	114936978	missense	possibly damaging	0.94
R5919:Oasl1	UTSW	5	114928270	missense	probably damaging	1.00
R6746:Oasl1	UTSW	5	114937183	missense	probably damaging	1.00
R7471:Oasl1	UTSW	5	114935926	missense	probably damaging	1.00
R7720:Oasl1	UTSW	5	114929921	missense	probably damaging	1.00
R7766:Oasl1	UTSW	5	114937110	missense	probably damaging	1.00
R8115:Oasl1	UTSW	5	114936937	missense	probably damaging	1.00
R8243:Oasl1	UTSW	5	114928161	missense	probably benign	0.04
R8358:Oasl1	UTSW	5	114937406	missense	probably benign	0.00
Z1177:Oasl1	UTSW	5	114932745	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ATTGTCTCTCTGTTGCAGGC -3'
(R):5'- GGCTACACAAAGAGGCCTTG -3'

Sequencing Primer
(F):5'- AGGCCTATCATCCTGGACC -3'
(R):5'- AAAGAGGCCTTGCTTCACTG -3'

Posted On

2016-09-01