Incidental Mutation 'R5443:Trim34a'
ID427272
Institutional Source Beutler Lab
Gene Symbol Trim34a
Ensembl Gene ENSMUSG00000056144
Gene Nametripartite motif-containing 34A
SynonymsTrim34-1, Trim34
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104244457-104262234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104260213 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 289 (F289S)
Ref Sequence ENSEMBL: ENSMUSP00000102462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060315] [ENSMUST00000098179] [ENSMUST00000106848] [ENSMUST00000106849]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060315
AA Change: F289S

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055058
Gene: ENSMUSG00000056144
AA Change: F289S

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 347 474 1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098179
SMART Domains Protein: ENSMUSP00000095781
Gene: ENSMUSG00000060441

DomainStartEndE-ValueType
RING 15 58 3.64e-7 SMART
BBOX 91 132 4.83e-12 SMART
Pfam:SPRY 351 493 1.6e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106848
AA Change: F289S

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102461
Gene: ENSMUSG00000056144
AA Change: F289S

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106849
AA Change: F289S

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102462
Gene: ENSMUSG00000056144
AA Change: F289S

DomainStartEndE-ValueType
RING 15 58 6.79e-7 SMART
BBOX 91 132 1.08e-9 SMART
coiled coil region 194 238 N/A INTRINSIC
Blast:PRY 299 343 2e-21 BLAST
Pfam:SPRY 345 484 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217156
Meta Mutation Damage Score 0.4864 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Trim34a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Trim34a APN 7 104261331 missense probably damaging 1.00
IGL00826:Trim34a APN 7 104260933 splice site probably null
IGL01526:Trim34a APN 7 104260499 missense probably damaging 1.00
IGL01859:Trim34a APN 7 104260942 missense probably damaging 0.96
IGL02052:Trim34a APN 7 104247831 missense probably benign 0.33
IGL02192:Trim34a APN 7 104247732 start codon destroyed probably null 1.00
IGL02351:Trim34a APN 7 104261234 nonsense probably null
IGL02358:Trim34a APN 7 104261234 nonsense probably null
IGL03326:Trim34a APN 7 104261380 missense probably benign 0.03
IGL03366:Trim34a APN 7 104260933 splice site probably null
Gold_belt UTSW 7 104261064 nonsense probably null
PIT4472001:Trim34a UTSW 7 104247948 missense probably damaging 1.00
PIT4791001:Trim34a UTSW 7 104260484 missense probably benign 0.15
R0115:Trim34a UTSW 7 104247902 missense probably damaging 1.00
R0848:Trim34a UTSW 7 104261124 missense probably benign
R1016:Trim34a UTSW 7 104247960 missense probably benign 0.10
R1477:Trim34a UTSW 7 104248080 missense possibly damaging 0.81
R1622:Trim34a UTSW 7 104261338 splice site probably null
R2287:Trim34a UTSW 7 104261055 missense probably damaging 1.00
R3685:Trim34a UTSW 7 104260126 splice site probably null
R4166:Trim34a UTSW 7 104261016 missense probably benign 0.02
R4967:Trim34a UTSW 7 104261064 nonsense probably null
R4979:Trim34a UTSW 7 104247862 missense probably benign 0.00
R5194:Trim34a UTSW 7 104260993 missense possibly damaging 0.70
R5631:Trim34a UTSW 7 104248739 missense probably damaging 1.00
R5902:Trim34a UTSW 7 104261121 nonsense probably null
R6147:Trim34a UTSW 7 104261191 missense probably damaging 0.99
R6644:Trim34a UTSW 7 104261037 missense probably damaging 1.00
R7971:Trim34a UTSW 7 104247818 missense probably damaging 0.98
R8060:Trim34a UTSW 7 104260976 missense probably damaging 1.00
R8278:Trim34a UTSW 7 104249416 missense probably damaging 0.99
X0023:Trim34a UTSW 7 104259415 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCTCAGGTATGAAGCACATCAG -3'
(R):5'- TCTCTCTAGAGGTAAGAAAGGGTG -3'

Sequencing Primer
(F):5'- CTCAGGTATGAAGCACATCAGTGATG -3'
(R):5'- AGGGTGGTATAAGAAGAGGTTTATG -3'
Posted On2016-09-01