Incidental Mutation 'R5443:Efnb2'
ID427277
Institutional Source Beutler Lab
Gene Symbol Efnb2
Ensembl Gene ENSMUSG00000001300
Gene Nameephrin B2
SynonymsLERK-5, Epl5, Htk-L, ELF-2, NLERK-1, Eplg5, Lerk5
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location8617434-8661242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8620862 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 129 (I129T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001319]
Predicted Effect probably damaging
Transcript: ENSMUST00000001319
AA Change: I246T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000001319
Gene: ENSMUSG00000001300
AA Change: I246T

DomainStartEndE-ValueType
Pfam:Ephrin 32 167 4.6e-53 PFAM
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152698
AA Change: I129T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116027
Gene: ENSMUSG00000001300
AA Change: I129T

DomainStartEndE-ValueType
Pfam:Ephrin 1 68 1.3e-19 PFAM
transmembrane domain 115 137 N/A INTRINSIC
low complexity region 151 161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208426
Meta Mutation Damage Score 0.1972 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in angiogenesis of both arteries and veins and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nrg1 A T 8: 31,849,320 Y208N probably damaging Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Efnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Efnb2 APN 8 8660589 missense probably benign 0.08
IGL02076:Efnb2 APN 8 8660488 missense probably benign
IGL03333:Efnb2 APN 8 8639275 nonsense probably null
IGL03098:Efnb2 UTSW 8 8663420 unclassified probably benign
R1416:Efnb2 UTSW 8 8622329 critical splice donor site probably null
R1760:Efnb2 UTSW 8 8623184 missense possibly damaging 0.90
R1783:Efnb2 UTSW 8 8623237 missense probably damaging 1.00
R4272:Efnb2 UTSW 8 8620698 missense probably damaging 0.99
R4398:Efnb2 UTSW 8 8620832 missense possibly damaging 0.80
R4782:Efnb2 UTSW 8 8623104 splice site probably null
R4799:Efnb2 UTSW 8 8623104 splice site probably null
R5193:Efnb2 UTSW 8 8623162 missense probably damaging 1.00
R5749:Efnb2 UTSW 8 8639347 missense probably damaging 1.00
R6083:Efnb2 UTSW 8 8622328 splice site probably null
R6266:Efnb2 UTSW 8 8660524 missense probably benign
R6482:Efnb2 UTSW 8 8620637 missense probably damaging 1.00
R7371:Efnb2 UTSW 8 8660524 missense probably benign
Z1177:Efnb2 UTSW 8 8623147 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTCTGCAGTCCTTAGTG -3'
(R):5'- TGTCAAGTTCGCTCTGAGGG -3'

Sequencing Primer
(F):5'- GGTATGATAACGTCACTGGGCTCC -3'
(R):5'- ACATTTCGGGGTTTCTGCAAG -3'
Posted On2016-09-01