Incidental Mutation 'R5443:Nrg1'
ID427278
Institutional Source Beutler Lab
Gene Symbol Nrg1
Ensembl Gene ENSMUSG00000062991
Gene Nameneuregulin 1
SynonymsD230005F13Rik, Hgl, GGF, HRGalpha, ARIA, 6030402G23Rik, HRG, GGFII, HGL, NDF, SMDF, heregulin
MMRRC Submission 043008-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5443 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31814551-32884029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31849320 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 208 (Y208N)
Ref Sequence ENSEMBL: ENSMUSP00000146403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073884] [ENSMUST00000207417] [ENSMUST00000207470] [ENSMUST00000208205] [ENSMUST00000208488] [ENSMUST00000208497] [ENSMUST00000208598] [ENSMUST00000208617] [ENSMUST00000208819] [ENSMUST00000208931] [ENSMUST00000209022] [ENSMUST00000209107]
Predicted Effect probably damaging
Transcript: ENSMUST00000073884
AA Change: Y263N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073546
Gene: ENSMUSG00000062991
AA Change: Y263N

DomainStartEndE-ValueType
transmembrane domain 78 100 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
EGF 236 277 7.88e-4 SMART
Pfam:Neuregulin 295 688 5.3e-193 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207417
AA Change: Y208N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000207470
AA Change: Y208N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207678
Predicted Effect probably damaging
Transcript: ENSMUST00000208205
AA Change: Y208N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000208335
AA Change: Y78N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208355
Predicted Effect probably damaging
Transcript: ENSMUST00000208488
AA Change: Y208N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000208497
AA Change: Y263N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208598
AA Change: Y208N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000208617
AA Change: Y208N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000208819
AA Change: Y208N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208820
Predicted Effect probably damaging
Transcript: ENSMUST00000208931
AA Change: Y84N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000209022
AA Change: Y215N

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209107
AA Change: Y215N

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.4279 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.9%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit heart defects, impaired development of Schwann cell precursors, cranial ganglia, and radial glia cells, and die at embryonic day 10.5-11.5. Heterozygotes are hyperactive with reduced NMDA receptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004E09Rik G T 16: 90,927,211 Q168K probably benign Het
Akap12 A T 10: 4,355,576 E795D probably damaging Het
Aldh6a1 T C 12: 84,437,971 probably null Het
Aox4 A G 1: 58,233,992 probably null Het
Arhgap39 G A 15: 76,797,925 probably benign Het
AW551984 T C 9: 39,598,029 E272G possibly damaging Het
C1qc G A 4: 136,892,493 probably benign Het
Carhsp1 C A 16: 8,664,339 R26L probably benign Het
Cdh12 G T 15: 21,237,849 V57L probably benign Het
Clec3a A G 8: 114,418,153 Y23C probably benign Het
Crebrf G C 17: 26,742,354 V150L probably damaging Het
Ddx41 G T 13: 55,535,291 A201E probably benign Het
Doc2b T C 11: 75,780,095 K237E probably damaging Het
Dst T C 1: 34,228,539 S5199P probably damaging Het
Efnb2 A G 8: 8,620,862 I129T probably damaging Het
Epg5 A G 18: 78,027,497 E2329G possibly damaging Het
Esrrg A C 1: 188,043,425 T27P possibly damaging Het
Fah T A 7: 84,592,396 R316W probably damaging Het
Fat4 T C 3: 39,010,370 L4825P probably damaging Het
Gabbr1 T C 17: 37,070,756 V804A probably damaging Het
Gm1322 G A 2: 67,184,668 noncoding transcript Het
Gm5114 T A 7: 39,408,865 K443N probably benign Het
Gnai2 T C 9: 107,620,187 I3V probably damaging Het
Gp2 G A 7: 119,454,598 P47S possibly damaging Het
I830127L07Rik A T 15: 75,133,719 noncoding transcript Het
Klf15 C A 6: 90,467,360 Q306K possibly damaging Het
Necab2 A T 8: 119,468,293 M295L probably benign Het
Nup88 A T 11: 70,958,430 Y232* probably null Het
Oacyl A G 18: 65,750,182 R611G probably benign Het
Oasl1 T C 5: 114,936,070 probably null Het
Olfr1061 A C 2: 86,413,593 I153R possibly damaging Het
Olfr138 T A 17: 38,275,014 M81K probably damaging Het
Olfr1384 G T 11: 49,514,435 G266C probably damaging Het
Olfr652 T C 7: 104,564,376 Y52H probably benign Het
Pate4 A C 9: 35,607,874 S66A possibly damaging Het
Pigl T A 11: 62,458,483 C8* probably null Het
Plg G A 17: 12,382,183 A51T probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Ppig A T 2: 69,734,291 D97V probably damaging Het
Ppp1r16a A G 15: 76,694,646 K517E possibly damaging Het
Prr16 A T 18: 51,303,153 S235C probably damaging Het
Psmd1 G A 1: 86,090,183 R572H probably damaging Het
Sbf2 T C 7: 110,377,928 probably benign Het
Scrt2 A T 2: 152,082,123 Y25F probably benign Het
Sema6d A T 2: 124,656,836 H222L probably damaging Het
Sept2 A G 1: 93,497,452 N110S possibly damaging Het
Shpk G A 11: 73,222,781 G340D possibly damaging Het
Smg5 T A 3: 88,354,589 L723H probably damaging Het
Sp110 C T 1: 85,589,120 E219K possibly damaging Het
Spo11 T C 2: 172,989,359 probably benign Het
Srarp T A 4: 141,436,077 probably null Het
Tbc1d5 A G 17: 50,735,967 I831T probably damaging Het
Tm9sf2 A T 14: 122,126,195 Y109F probably damaging Het
Tmem57 A T 4: 134,833,308 C121* probably null Het
Tpcn2 A T 7: 145,255,472 M699K possibly damaging Het
Trim34a T C 7: 104,260,213 F289S possibly damaging Het
Trim39 T C 17: 36,260,753 H371R probably damaging Het
Usp48 T A 4: 137,621,221 I11N possibly damaging Het
Zbtb10 T C 3: 9,280,048 F677L probably benign Het
Zer1 C T 2: 30,110,996 G138S probably damaging Het
Zfp612 A G 8: 110,089,595 K439R possibly damaging Het
Other mutations in Nrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Nrg1 APN 8 31818089 missense probably damaging 0.99
IGL00500:Nrg1 APN 8 31822314 splice site probably null
IGL01150:Nrg1 APN 8 31917875 missense probably damaging 1.00
IGL01998:Nrg1 APN 8 31918134 missense probably damaging 0.99
IGL02010:Nrg1 APN 8 31918143 missense probably benign 0.00
IGL02501:Nrg1 APN 8 31818263 splice site probably null
IGL02741:Nrg1 APN 8 31822288 missense probably damaging 1.00
IGL02754:Nrg1 APN 8 31826363 splice site probably benign
IGL03056:Nrg1 APN 8 31821423 missense possibly damaging 0.93
IGL03121:Nrg1 APN 8 31824580 splice site probably benign
R6805_Nrg1_535 UTSW 8 31821264 missense probably damaging 1.00
R0533:Nrg1 UTSW 8 31831245 splice site probably null
R1170:Nrg1 UTSW 8 31837667 splice site probably benign
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1405:Nrg1 UTSW 8 31917827 missense probably benign 0.16
R1486:Nrg1 UTSW 8 31818344 missense probably damaging 1.00
R1642:Nrg1 UTSW 8 31824508 missense probably benign 0.45
R1653:Nrg1 UTSW 8 31818653 missense probably damaging 1.00
R1762:Nrg1 UTSW 8 31822323 missense probably damaging 0.99
R1951:Nrg1 UTSW 8 31918193 missense probably damaging 1.00
R2060:Nrg1 UTSW 8 31918015 missense probably damaging 1.00
R2912:Nrg1 UTSW 8 31818567 missense probably damaging 1.00
R3786:Nrg1 UTSW 8 31821383 missense probably damaging 1.00
R4513:Nrg1 UTSW 8 32477077 intron probably benign
R4569:Nrg1 UTSW 8 31917774 missense probably benign 0.00
R4760:Nrg1 UTSW 8 31918200 nonsense probably null
R4769:Nrg1 UTSW 8 31917972 missense probably damaging 1.00
R4834:Nrg1 UTSW 8 31917719 missense probably benign
R5058:Nrg1 UTSW 8 31824559 missense probably damaging 1.00
R5230:Nrg1 UTSW 8 31818479 missense probably damaging 0.99
R5479:Nrg1 UTSW 8 31818377 missense probably damaging 1.00
R5940:Nrg1 UTSW 8 31849344 missense probably damaging 0.99
R6010:Nrg1 UTSW 8 31818572 missense probably damaging 1.00
R6170:Nrg1 UTSW 8 31818480 missense probably damaging 1.00
R6379:Nrg1 UTSW 8 32883721 start gained probably benign
R6460:Nrg1 UTSW 8 31818533 missense probably damaging 1.00
R6750:Nrg1 UTSW 8 31818096 missense probably damaging 1.00
R6767:Nrg1 UTSW 8 31917895 missense probably damaging 1.00
R6802:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6804:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6805:Nrg1 UTSW 8 31821264 missense probably damaging 1.00
R6848:Nrg1 UTSW 8 31818056 missense probably damaging 1.00
R6930:Nrg1 UTSW 8 31818506 missense probably damaging 1.00
R6963:Nrg1 UTSW 8 31917662 missense probably benign 0.04
R7070:Nrg1 UTSW 8 31849437 missense probably damaging 0.99
R7176:Nrg1 UTSW 8 31968036 nonsense probably null
R7490:Nrg1 UTSW 8 31818654 missense probably damaging 1.00
R7526:Nrg1 UTSW 8 31818323 missense probably benign 0.00
R7664:Nrg1 UTSW 8 32009141 splice site probably null
R7881:Nrg1 UTSW 8 31838324 nonsense probably null
R8013:Nrg1 UTSW 8 31949923 missense probably benign 0.41
R8342:Nrg1 UTSW 8 31822306 missense probably benign 0.04
Z1088:Nrg1 UTSW 8 31918005 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- ATTCTGAACATGACAGAGGCAATG -3'
(R):5'- ATCACTCTTGAGCCGTGCTAG -3'

Sequencing Primer
(F):5'- CATGACAGAGGCAATGGCAGATG -3'
(R):5'- CAACGGTGATTATAGTCTCAGAACC -3'
Posted On2016-09-01