Mutagenetix > Incidental Mutation

Incidental Mutation 'R5443:Plg'

427301

Institutional Source

Beutler Lab

Gene Symbol

Plg

Ensembl Gene

ENSMUSG00000059481

Gene Name

plasminogen

Synonyms

MMRRC Submission

043008-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R5443 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12378609-12419384 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 12382183 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 51 (A51T)

Ref Sequence

ENSEMBL: ENSMUSP00000014578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014578]

AlphaFold

P20918

Predicted Effect

probably benign
Transcript: ENSMUST00000014578
AA Change: A51T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: A51T

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
PAN_AP	20	97	8.67e-14	SMART
KR	101	183	1.31e-41	SMART
KR	184	264	5.4e-43	SMART
KR	273	354	3.45e-50	SMART
KR	375	456	3.9e-49	SMART
KR	479	562	5.53e-40	SMART
Tryp_SPc	581	805	4.11e-94	SMART

Meta Mutation Damage Score

0.4968

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	G	T	16: 90,927,211	Q168K	probably benign	Het
Akap12	A	T	10: 4,355,576	E795D	probably damaging	Het
Aldh6a1	T	C	12: 84,437,971		probably null	Het
Aox4	A	G	1: 58,233,992		probably null	Het
Arhgap39	G	A	15: 76,797,925		probably benign	Het
AW551984	T	C	9: 39,598,029	E272G	possibly damaging	Het
C1qc	G	A	4: 136,892,493		probably benign	Het
Carhsp1	C	A	16: 8,664,339	R26L	probably benign	Het
Cdh12	G	T	15: 21,237,849	V57L	probably benign	Het
Clec3a	A	G	8: 114,418,153	Y23C	probably benign	Het
Crebrf	G	C	17: 26,742,354	V150L	probably damaging	Het
Ddx41	G	T	13: 55,535,291	A201E	probably benign	Het
Doc2b	T	C	11: 75,780,095	K237E	probably damaging	Het
Dst	T	C	1: 34,228,539	S5199P	probably damaging	Het
Efnb2	A	G	8: 8,620,862	I129T	probably damaging	Het
Epg5	A	G	18: 78,027,497	E2329G	possibly damaging	Het
Esrrg	A	C	1: 188,043,425	T27P	possibly damaging	Het
Fah	T	A	7: 84,592,396	R316W	probably damaging	Het
Fat4	T	C	3: 39,010,370	L4825P	probably damaging	Het
Gabbr1	T	C	17: 37,070,756	V804A	probably damaging	Het
Gm1322	G	A	2: 67,184,668		noncoding transcript	Het
Gm5114	T	A	7: 39,408,865	K443N	probably benign	Het
Gnai2	T	C	9: 107,620,187	I3V	probably damaging	Het
Gp2	G	A	7: 119,454,598	P47S	possibly damaging	Het
I830127L07Rik	A	T	15: 75,133,719		noncoding transcript	Het
Klf15	C	A	6: 90,467,360	Q306K	possibly damaging	Het
Necab2	A	T	8: 119,468,293	M295L	probably benign	Het
Nrg1	A	T	8: 31,849,320	Y208N	probably damaging	Het
Nup88	A	T	11: 70,958,430	Y232*	probably null	Het
Oacyl	A	G	18: 65,750,182	R611G	probably benign	Het
Oasl1	T	C	5: 114,936,070		probably null	Het
Olfr1061	A	C	2: 86,413,593	I153R	possibly damaging	Het
Olfr138	T	A	17: 38,275,014	M81K	probably damaging	Het
Olfr1384	G	T	11: 49,514,435	G266C	probably damaging	Het
Olfr652	T	C	7: 104,564,376	Y52H	probably benign	Het
Pate4	A	C	9: 35,607,874	S66A	possibly damaging	Het
Pigl	T	A	11: 62,458,483	C8*	probably null	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppig	A	T	2: 69,734,291	D97V	probably damaging	Het
Ppp1r16a	A	G	15: 76,694,646	K517E	possibly damaging	Het
Prr16	A	T	18: 51,303,153	S235C	probably damaging	Het
Psmd1	G	A	1: 86,090,183	R572H	probably damaging	Het
Sbf2	T	C	7: 110,377,928		probably benign	Het
Scrt2	A	T	2: 152,082,123	Y25F	probably benign	Het
Sema6d	A	T	2: 124,656,836	H222L	probably damaging	Het
Sept2	A	G	1: 93,497,452	N110S	possibly damaging	Het
Shpk	G	A	11: 73,222,781	G340D	possibly damaging	Het
Smg5	T	A	3: 88,354,589	L723H	probably damaging	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Spo11	T	C	2: 172,989,359		probably benign	Het
Srarp	T	A	4: 141,436,077		probably null	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tm9sf2	A	T	14: 122,126,195	Y109F	probably damaging	Het
Tmem57	A	T	4: 134,833,308	C121*	probably null	Het
Tpcn2	A	T	7: 145,255,472	M699K	possibly damaging	Het
Trim34a	T	C	7: 104,260,213	F289S	possibly damaging	Het
Trim39	T	C	17: 36,260,753	H371R	probably damaging	Het
Usp48	T	A	4: 137,621,221	I11N	possibly damaging	Het
Zbtb10	T	C	3: 9,280,048	F677L	probably benign	Het
Zer1	C	T	2: 30,110,996	G138S	probably damaging	Het
Zfp612	A	G	8: 110,089,595	K439R	possibly damaging	Het

Other mutations in Plg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00834:Plg	APN	17	12411493	missense	probably damaging	1.00
IGL01128:Plg	APN	17	12396699	splice site	probably benign
IGL01522:Plg	APN	17	12404069	missense	probably damaging	1.00
IGL01981:Plg	APN	17	12403047	splice site	probably benign
IGL03338:Plg	APN	17	12419072	missense	probably damaging	1.00
elder	UTSW	17	12390220	nonsense	probably null
oldster	UTSW	17	12395754	missense	probably damaging	1.00
R0391:Plg	UTSW	17	12419081	missense	probably damaging	1.00
R0531:Plg	UTSW	17	12411447	splice site	probably benign
R0646:Plg	UTSW	17	12418736	missense	probably damaging	1.00
R0759:Plg	UTSW	17	12410951	missense	probably damaging	1.00
R1013:Plg	UTSW	17	12378721	splice site	probably benign
R2116:Plg	UTSW	17	12384477	missense	probably damaging	0.99
R2442:Plg	UTSW	17	12410960	missense	probably benign	0.15
R2512:Plg	UTSW	17	12403229	missense	probably benign
R2879:Plg	UTSW	17	12404100	missense	possibly damaging	0.92
R3107:Plg	UTSW	17	12384429	missense	probably benign	0.00
R3405:Plg	UTSW	17	12403209	missense	possibly damaging	0.65
R4409:Plg	UTSW	17	12390263	missense	probably damaging	1.00
R4861:Plg	UTSW	17	12395735	missense	probably benign	0.00
R4861:Plg	UTSW	17	12395735	missense	probably benign	0.00
R4977:Plg	UTSW	17	12403089	missense	probably damaging	1.00
R4990:Plg	UTSW	17	12411510	missense	probably benign
R5319:Plg	UTSW	17	12403227	missense	possibly damaging	0.49
R5635:Plg	UTSW	17	12395754	missense	probably damaging	1.00
R5981:Plg	UTSW	17	12378718	critical splice donor site	probably null
R6166:Plg	UTSW	17	12398114	missense	probably damaging	0.99
R6688:Plg	UTSW	17	12391845	missense	probably damaging	1.00
R6726:Plg	UTSW	17	12378708	missense	probably damaging	1.00
R6995:Plg	UTSW	17	12419051	missense	probably benign	0.00
R7028:Plg	UTSW	17	12391836	missense	probably damaging	1.00
R7168:Plg	UTSW	17	12388559	missense	probably damaging	1.00
R7356:Plg	UTSW	17	12410911	missense	probably damaging	1.00
R8902:Plg	UTSW	17	12410903	missense	probably benign	0.32
R9035:Plg	UTSW	17	12390220	nonsense	probably null
R9474:Plg	UTSW	17	12403137	missense	probably damaging	1.00
R9610:Plg	UTSW	17	12390326	missense	probably benign	0.12
R9611:Plg	UTSW	17	12390326	missense	probably benign	0.12
Z1176:Plg	UTSW	17	12414185	missense	probably benign	0.02
Z1177:Plg	UTSW	17	12403233	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCATGAAATATGCACATGC -3'
(R):5'- AGCCCTGTAAACCATCTTTACCTTG -3'

Sequencing Primer
(F):5'- TGTGCTTATACACACACACACAC -3'
(R):5'- TACATTGAGGTCAGAGGACACCTTTG -3'

Posted On

2016-09-01