Mutagenetix > Incidental Mutations

Incidental Mutation 'R5443:Trim39'

427303

Institutional Source

Beutler Lab

Gene Symbol

Trim39

Ensembl Gene

ENSMUSG00000045409

Gene Name

tripartite motif-containing 39

Synonyms

Rnf23, RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, E130103K13Rik

MMRRC Submission

043008-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5443 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

36258873-36272247 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36260753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 371 (H371R)

Ref Sequence

ENSEMBL: ENSMUSP00000133298 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025319] [ENSMUST00000042717] [ENSMUST00000077535] [ENSMUST00000113706] [ENSMUST00000172573] [ENSMUST00000173369] [ENSMUST00000173665]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000025319

SMART Domains

Protein: ENSMUSP00000025319
Gene: ENSMUSG00000024446

Domain	Start	End	E-Value	Type
Pfam:Rpr2	13	96	1.2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000042717
AA Change: H363R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039790
Gene: ENSMUSG00000045409
AA Change: H363R

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
RING	29	69	1.9e-10	SMART
BBOX	102	143	3.21e-8	SMART
coiled coil region	184	240	N/A	INTRINSIC
PRY	306	359	2.3e-27	SMART
SPRY	360	485	1.95e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000077535

SMART Domains

Protein: ENSMUSP00000076739
Gene: ENSMUSG00000024446

Domain	Start	End	E-Value	Type
low complexity region	28	42	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000113704

Predicted Effect

probably damaging
Transcript: ENSMUST00000113706
AA Change: H363R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109336
Gene: ENSMUSG00000045409
AA Change: H363R

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
RING	29	69	1.9e-10	SMART
BBOX	102	143	3.21e-8	SMART
coiled coil region	184	240	N/A	INTRINSIC
PRY	306	359	2.3e-27	SMART
SPRY	360	485	1.95e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172573

SMART Domains

Protein: ENSMUSP00000133400
Gene: ENSMUSG00000024446

Domain	Start	End	E-Value	Type
Pfam:Rpr2	1	48	4.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172832

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173122

Predicted Effect

probably damaging
Transcript: ENSMUST00000173369
AA Change: H371R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133298
Gene: ENSMUSG00000045409
AA Change: H371R

Domain	Start	End	E-Value	Type
low complexity region	4	21	N/A	INTRINSIC
RING	29	69	1.9e-10	SMART
BBOX	102	143	3.21e-8	SMART
coiled coil region	184	240	N/A	INTRINSIC
PRY	314	367	1.23e-27	SMART
SPRY	368	493	1.95e-31	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173486

Predicted Effect

probably benign
Transcript: ENSMUST00000173665

SMART Domains

Protein: ENSMUSP00000133529
Gene: ENSMUSG00000045409

Domain	Start	End	E-Value	Type
BBOX	1	40	5.81e-6	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174197

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174824

Meta Mutation Damage Score

0.9141

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	G	T	16: 90,927,211	Q168K	probably benign	Het
Akap12	A	T	10: 4,355,576	E795D	probably damaging	Het
Aldh6a1	T	C	12: 84,437,971		probably null	Het
Aox4	A	G	1: 58,233,992		probably null	Het
Arhgap39	G	A	15: 76,797,925		probably benign	Het
AW551984	T	C	9: 39,598,029	E272G	possibly damaging	Het
C1qc	G	A	4: 136,892,493		probably benign	Het
Carhsp1	C	A	16: 8,664,339	R26L	probably benign	Het
Cdh12	G	T	15: 21,237,849	V57L	probably benign	Het
Clec3a	A	G	8: 114,418,153	Y23C	probably benign	Het
Crebrf	G	C	17: 26,742,354	V150L	probably damaging	Het
Ddx41	G	T	13: 55,535,291	A201E	probably benign	Het
Doc2b	T	C	11: 75,780,095	K237E	probably damaging	Het
Dst	T	C	1: 34,228,539	S5199P	probably damaging	Het
Efnb2	A	G	8: 8,620,862	I129T	probably damaging	Het
Epg5	A	G	18: 78,027,497	E2329G	possibly damaging	Het
Esrrg	A	C	1: 188,043,425	T27P	possibly damaging	Het
Fah	T	A	7: 84,592,396	R316W	probably damaging	Het
Fat4	T	C	3: 39,010,370	L4825P	probably damaging	Het
Gabbr1	T	C	17: 37,070,756	V804A	probably damaging	Het
Gm1322	G	A	2: 67,184,668		noncoding transcript	Het
Gm5114	T	A	7: 39,408,865	K443N	probably benign	Het
Gnai2	T	C	9: 107,620,187	I3V	probably damaging	Het
Gp2	G	A	7: 119,454,598	P47S	possibly damaging	Het
I830127L07Rik	A	T	15: 75,133,719		noncoding transcript	Het
Klf15	C	A	6: 90,467,360	Q306K	possibly damaging	Het
Necab2	A	T	8: 119,468,293	M295L	probably benign	Het
Nrg1	A	T	8: 31,849,320	Y208N	probably damaging	Het
Nup88	A	T	11: 70,958,430	Y232*	probably null	Het
Oacyl	A	G	18: 65,750,182	R611G	probably benign	Het
Oasl1	T	C	5: 114,936,070		probably null	Het
Olfr1061	A	C	2: 86,413,593	I153R	possibly damaging	Het
Olfr138	T	A	17: 38,275,014	M81K	probably damaging	Het
Olfr1384	G	T	11: 49,514,435	G266C	probably damaging	Het
Olfr652	T	C	7: 104,564,376	Y52H	probably benign	Het
Pate4	A	C	9: 35,607,874	S66A	possibly damaging	Het
Pigl	T	A	11: 62,458,483	C8*	probably null	Het
Plg	G	A	17: 12,382,183	A51T	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppig	A	T	2: 69,734,291	D97V	probably damaging	Het
Ppp1r16a	A	G	15: 76,694,646	K517E	possibly damaging	Het
Prr16	A	T	18: 51,303,153	S235C	probably damaging	Het
Psmd1	G	A	1: 86,090,183	R572H	probably damaging	Het
Sbf2	T	C	7: 110,377,928		probably benign	Het
Scrt2	A	T	2: 152,082,123	Y25F	probably benign	Het
Sema6d	A	T	2: 124,656,836	H222L	probably damaging	Het
Sept2	A	G	1: 93,497,452	N110S	possibly damaging	Het
Shpk	G	A	11: 73,222,781	G340D	possibly damaging	Het
Smg5	T	A	3: 88,354,589	L723H	probably damaging	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Spo11	T	C	2: 172,989,359		probably benign	Het
Srarp	T	A	4: 141,436,077		probably null	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tm9sf2	A	T	14: 122,126,195	Y109F	probably damaging	Het
Tmem57	A	T	4: 134,833,308	C121*	probably null	Het
Tpcn2	A	T	7: 145,255,472	M699K	possibly damaging	Het
Trim34a	T	C	7: 104,260,213	F289S	possibly damaging	Het
Usp48	T	A	4: 137,621,221	I11N	possibly damaging	Het
Zbtb10	T	C	3: 9,280,048	F677L	probably benign	Het
Zer1	C	T	2: 30,110,996	G138S	probably damaging	Het
Zfp612	A	G	8: 110,089,595	K439R	possibly damaging	Het

Other mutations in Trim39

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01458:Trim39	APN	17	36263963	splice site	probably benign
IGL01462:Trim39	APN	17	36263725	splice site	probably benign
IGL02243:Trim39	APN	17	36260384	missense	probably damaging	1.00
IGL03390:Trim39	APN	17	36260571	missense	probably damaging	0.99
barba	UTSW	17	36268854	missense	probably damaging	1.00
rossa	UTSW	17	36260915	missense	probably damaging	1.00
PIT4305001:Trim39	UTSW	17	36268970	missense	possibly damaging	0.93
R0458:Trim39	UTSW	17	36261512	missense	probably damaging	1.00
R0569:Trim39	UTSW	17	36263731	missense	probably benign	0.36
R1565:Trim39	UTSW	17	36268854	missense	probably damaging	1.00
R1769:Trim39	UTSW	17	36263940	missense	probably damaging	1.00
R1969:Trim39	UTSW	17	36268753	missense	probably benign	0.01
R2009:Trim39	UTSW	17	36263754	missense	possibly damaging	0.92
R2568:Trim39	UTSW	17	36269164	unclassified	probably benign
R5206:Trim39	UTSW	17	36260490	missense	probably damaging	1.00
R6481:Trim39	UTSW	17	36268662	missense	probably benign	0.03
R7132:Trim39	UTSW	17	36260655	missense	probably benign	0.25
R7563:Trim39	UTSW	17	36260915	missense	probably damaging	1.00
R7739:Trim39	UTSW	17	36260504	missense	possibly damaging	0.50
R8433:Trim39	UTSW	17	36260705	missense	possibly damaging	0.87
R9200:Trim39	UTSW	17	36268775	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TCACCTTGATGTGCAAAGGG -3'
(R):5'- GGACGTTTAGCTATTCCCATCC -3'

Sequencing Primer
(F):5'- CCTTGATGTGCAAAGGGGTAAAAG -3'
(R):5'- CATCTAGCTCCACTCTGGC -3'

Posted On

2016-09-01