Mutagenetix > Incidental Mutations

Incidental Mutation 'R5443:Gabbr1'

427304

Institutional Source

Beutler Lab

Gene Symbol

Gabbr1

Ensembl Gene

ENSMUSG00000024462

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 1

Synonyms

GABAB1, GABAbR1

MMRRC Submission

043008-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.545) question?

Stock #

R5443 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37045966-37075067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 37070756 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 804 (V804A)

Ref Sequence

ENSEMBL: ENSMUSP00000025338 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823]

AlphaFold

Q9WV18

Predicted Effect

probably damaging
Transcript: ENSMUST00000025338
AA Change: V804A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: V804A

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CCP	29	95	8.72e0	SMART
CCP	99	156	3.03e-10	SMART
Pfam:Peripla_BP_6	168	538	1.6e-23	PFAM
Pfam:ANF_receptor	186	542	4.3e-73	PFAM
Pfam:7tm_3	602	858	9.8e-49	PFAM
coiled coil region	877	922	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172792
AA Change: V688A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: V688A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
low complexity region	30	51	N/A	INTRINSIC
Pfam:Peripla_BP_6	52	428	7.8e-24	PFAM
Pfam:ANF_receptor	70	426	5.7e-68	PFAM
Pfam:7tm_3	484	743	1.1e-50	PFAM
coiled coil region	761	806	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000173823

SMART Domains

Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Sushi	29	95	1.6e-6	PFAM
low complexity region	159	176	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174071

Meta Mutation Damage Score

0.4040

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110004E09Rik	G	T	16: 90,927,211	Q168K	probably benign	Het
Akap12	A	T	10: 4,355,576	E795D	probably damaging	Het
Aldh6a1	T	C	12: 84,437,971		probably null	Het
Aox4	A	G	1: 58,233,992		probably null	Het
Arhgap39	G	A	15: 76,797,925		probably benign	Het
AW551984	T	C	9: 39,598,029	E272G	possibly damaging	Het
C1qc	G	A	4: 136,892,493		probably benign	Het
Carhsp1	C	A	16: 8,664,339	R26L	probably benign	Het
Cdh12	G	T	15: 21,237,849	V57L	probably benign	Het
Clec3a	A	G	8: 114,418,153	Y23C	probably benign	Het
Crebrf	G	C	17: 26,742,354	V150L	probably damaging	Het
Ddx41	G	T	13: 55,535,291	A201E	probably benign	Het
Doc2b	T	C	11: 75,780,095	K237E	probably damaging	Het
Dst	T	C	1: 34,228,539	S5199P	probably damaging	Het
Efnb2	A	G	8: 8,620,862	I129T	probably damaging	Het
Epg5	A	G	18: 78,027,497	E2329G	possibly damaging	Het
Esrrg	A	C	1: 188,043,425	T27P	possibly damaging	Het
Fah	T	A	7: 84,592,396	R316W	probably damaging	Het
Fat4	T	C	3: 39,010,370	L4825P	probably damaging	Het
Gm1322	G	A	2: 67,184,668		noncoding transcript	Het
Gm5114	T	A	7: 39,408,865	K443N	probably benign	Het
Gnai2	T	C	9: 107,620,187	I3V	probably damaging	Het
Gp2	G	A	7: 119,454,598	P47S	possibly damaging	Het
I830127L07Rik	A	T	15: 75,133,719		noncoding transcript	Het
Klf15	C	A	6: 90,467,360	Q306K	possibly damaging	Het
Necab2	A	T	8: 119,468,293	M295L	probably benign	Het
Nrg1	A	T	8: 31,849,320	Y208N	probably damaging	Het
Nup88	A	T	11: 70,958,430	Y232*	probably null	Het
Oacyl	A	G	18: 65,750,182	R611G	probably benign	Het
Oasl1	T	C	5: 114,936,070		probably null	Het
Olfr1061	A	C	2: 86,413,593	I153R	possibly damaging	Het
Olfr138	T	A	17: 38,275,014	M81K	probably damaging	Het
Olfr1384	G	T	11: 49,514,435	G266C	probably damaging	Het
Olfr652	T	C	7: 104,564,376	Y52H	probably benign	Het
Pate4	A	C	9: 35,607,874	S66A	possibly damaging	Het
Pigl	T	A	11: 62,458,483	C8*	probably null	Het
Plg	G	A	17: 12,382,183	A51T	probably benign	Het
Polr3a	T	C	14: 24,454,941	I1084V	possibly damaging	Het
Ppig	A	T	2: 69,734,291	D97V	probably damaging	Het
Ppp1r16a	A	G	15: 76,694,646	K517E	possibly damaging	Het
Prr16	A	T	18: 51,303,153	S235C	probably damaging	Het
Psmd1	G	A	1: 86,090,183	R572H	probably damaging	Het
Sbf2	T	C	7: 110,377,928		probably benign	Het
Scrt2	A	T	2: 152,082,123	Y25F	probably benign	Het
Sema6d	A	T	2: 124,656,836	H222L	probably damaging	Het
Sept2	A	G	1: 93,497,452	N110S	possibly damaging	Het
Shpk	G	A	11: 73,222,781	G340D	possibly damaging	Het
Smg5	T	A	3: 88,354,589	L723H	probably damaging	Het
Sp110	C	T	1: 85,589,120	E219K	possibly damaging	Het
Spo11	T	C	2: 172,989,359		probably benign	Het
Srarp	T	A	4: 141,436,077		probably null	Het
Tbc1d5	A	G	17: 50,735,967	I831T	probably damaging	Het
Tm9sf2	A	T	14: 122,126,195	Y109F	probably damaging	Het
Tmem57	A	T	4: 134,833,308	C121*	probably null	Het
Tpcn2	A	T	7: 145,255,472	M699K	possibly damaging	Het
Trim34a	T	C	7: 104,260,213	F289S	possibly damaging	Het
Trim39	T	C	17: 36,260,753	H371R	probably damaging	Het
Usp48	T	A	4: 137,621,221	I11N	possibly damaging	Het
Zbtb10	T	C	3: 9,280,048	F677L	probably benign	Het
Zer1	C	T	2: 30,110,996	G138S	probably damaging	Het
Zfp612	A	G	8: 110,089,595	K439R	possibly damaging	Het

Other mutations in Gabbr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Gabbr1	APN	17	37048443	nonsense	probably null
IGL01309:Gabbr1	APN	17	37048607	critical splice donor site	probably null
IGL01413:Gabbr1	APN	17	37062706	missense	possibly damaging	0.93
IGL01568:Gabbr1	APN	17	37070669	missense	probably damaging	1.00
IGL01845:Gabbr1	APN	17	37048414	splice site	probably benign
IGL02083:Gabbr1	APN	17	37070065	missense	possibly damaging	0.84
IGL02302:Gabbr1	APN	17	37054797	missense	probably damaging	1.00
IGL02430:Gabbr1	APN	17	37056308	nonsense	probably null
IGL02533:Gabbr1	APN	17	37072147	missense	probably damaging	1.00
IGL02810:Gabbr1	APN	17	37062762	missense	probably damaging	1.00
H8562:Gabbr1	UTSW	17	37071949	missense	probably damaging	1.00
PIT4449001:Gabbr1	UTSW	17	37056350	missense	probably damaging	1.00
R0025:Gabbr1	UTSW	17	37067210	intron	probably benign
R0420:Gabbr1	UTSW	17	37046762	missense	possibly damaging	0.68
R0464:Gabbr1	UTSW	17	37050834	unclassified	probably benign
R1306:Gabbr1	UTSW	17	37055990	splice site	probably null
R1412:Gabbr1	UTSW	17	37054913	splice site	probably null
R1495:Gabbr1	UTSW	17	37055940	missense	possibly damaging	0.68
R1612:Gabbr1	UTSW	17	37070669	missense	probably damaging	1.00
R1658:Gabbr1	UTSW	17	37047507	missense	probably damaging	0.96
R1763:Gabbr1	UTSW	17	37054767	missense	probably damaging	1.00
R1779:Gabbr1	UTSW	17	37054879	missense	probably damaging	1.00
R1964:Gabbr1	UTSW	17	37048459	missense	probably damaging	1.00
R1996:Gabbr1	UTSW	17	37069220	missense	probably damaging	1.00
R2014:Gabbr1	UTSW	17	37056782	splice site	probably null
R2255:Gabbr1	UTSW	17	37071866	missense	probably damaging	1.00
R4299:Gabbr1	UTSW	17	37055900	nonsense	probably null
R4458:Gabbr1	UTSW	17	37067775	critical splice acceptor site	probably null
R4510:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4511:Gabbr1	UTSW	17	37069211	missense	probably damaging	1.00
R4571:Gabbr1	UTSW	17	37054236	nonsense	probably null
R4597:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.74
R5109:Gabbr1	UTSW	17	37072028	intron	probably benign
R5119:Gabbr1	UTSW	17	37048438	missense	probably damaging	0.99
R5227:Gabbr1	UTSW	17	37070066	missense	possibly damaging	0.93
R5253:Gabbr1	UTSW	17	37055913	missense	possibly damaging	0.87
R5485:Gabbr1	UTSW	17	37056875	missense	possibly damaging	0.83
R5839:Gabbr1	UTSW	17	37067868	missense	probably damaging	1.00
R5976:Gabbr1	UTSW	17	37067862	missense	probably damaging	1.00
R6156:Gabbr1	UTSW	17	37048427	missense	probably benign	0.01
R6167:Gabbr1	UTSW	17	37063379	missense	probably damaging	1.00
R6214:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6215:Gabbr1	UTSW	17	37069365	missense	probably damaging	1.00
R6348:Gabbr1	UTSW	17	37056899	missense	possibly damaging	0.94
R6721:Gabbr1	UTSW	17	37054192	missense	probably damaging	0.98
R7028:Gabbr1	UTSW	17	37064737	nonsense	probably null
R7317:Gabbr1	UTSW	17	37069413	missense	probably damaging	1.00
R7786:Gabbr1	UTSW	17	37070063	missense	probably damaging	0.98
R7793:Gabbr1	UTSW	17	37047501	missense	probably benign	0.13
R7833:Gabbr1	UTSW	17	37056969	missense	possibly damaging	0.88
R8110:Gabbr1	UTSW	17	37048583	missense	probably benign	0.10
R8318:Gabbr1	UTSW	17	37062543	missense	probably benign	0.23
R8774:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8774-TAIL:Gabbr1	UTSW	17	37071857	missense	probably damaging	1.00
R8890:Gabbr1	UTSW	17	37047544	missense	probably benign	0.02
R9144:Gabbr1	UTSW	17	37051157	missense	probably benign
R9292:Gabbr1	UTSW	17	37055892	missense	possibly damaging	0.94
R9359:Gabbr1	UTSW	17	37070713	missense	probably damaging	1.00
X0010:Gabbr1	UTSW	17	37070780	missense	probably damaging	0.99
Z1177:Gabbr1	UTSW	17	37048424	missense	possibly damaging	0.57

Predicted Primers

PCR Primer
(F):5'- GGCTTTCTTTACACAGAGGAGC -3'
(R):5'- GCTCACGTTTCCTCGAGAAAG -3'

Sequencing Primer
(F):5'- TCTTTACACAGAGGAGCTACAAAG -3'
(R):5'- GGTGGCTCACAACCATCTATATGG -3'

Posted On

2016-09-01