Mutagenetix > Incidental Mutation

Incidental Mutation 'R5444:Slfn10-ps'

427352

Institutional Source

Beutler Lab

Gene Symbol

Slfn10-ps

Ensembl Gene

ENSMUSG00000072621

Gene Name

schlafen 10, pseudogene

Synonyms

MMRRC Submission

043009-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R5444 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

82919681-82926992 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 82926113 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000100716

SMART Domains

Protein: ENSMUSP00000098282
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AlbA_2	142	278	1.3e-13	PFAM
Pfam:DUF2075	529	697	1.6e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152760

SMART Domains

Protein: ENSMUSP00000130353
Gene: ENSMUSG00000072621

Domain	Start	End	E-Value	Type
Pfam:AAA_4	142	280	1.8e-14	PFAM
Pfam:DUF2075	529	693	1.8e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215473

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.1%

Validation Efficiency

99% (66/67)

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930584F24Rik	A	G	5: 26,684,735 (GRCm39)		noncoding transcript	Het
Adam11	A	G	11: 102,663,674 (GRCm39)	Q284R	probably damaging	Het
Adamts17	T	A	7: 66,691,647 (GRCm39)	H610Q	probably benign	Het
Alg6	A	G	4: 99,629,816 (GRCm39)	Y131C	probably benign	Het
Apol9b	T	C	15: 77,619,963 (GRCm39)	I253T	probably damaging	Het
Asb4	T	A	6: 5,431,040 (GRCm39)	I425N	probably damaging	Het
Atic	T	C	1: 71,615,876 (GRCm39)	L474P	probably damaging	Het
B3glct	C	T	5: 149,669,985 (GRCm39)	T318I	probably damaging	Het
Bbs7	T	C	3: 36,666,199 (GRCm39)	K22E	possibly damaging	Het
Cdk17	T	G	10: 93,053,823 (GRCm39)		probably null	Het
Cemip	T	A	7: 83,631,499 (GRCm39)	T438S	probably damaging	Het
Chd2	T	C	7: 73,122,833 (GRCm39)	E967G	probably damaging	Het
Cyp2d26	G	T	15: 82,676,739 (GRCm39)	D202E	probably benign	Het
Dhdds	G	A	4: 133,698,447 (GRCm39)	R295*	probably null	Het
Eef2kmt	G	A	16: 5,066,959 (GRCm39)		probably benign	Het
Fn3krp	G	A	11: 121,312,430 (GRCm39)		probably null	Het
Gjc3	G	A	5: 137,955,809 (GRCm39)	L159F	probably damaging	Het
Gm28434	T	C	5: 88,127,147 (GRCm39)		probably benign	Het
Gp2	G	A	7: 119,053,821 (GRCm39)	P47S	possibly damaging	Het
Irf7	C	T	7: 140,844,732 (GRCm39)		probably benign	Het
Itgb8	T	C	12: 119,201,573 (GRCm39)		probably benign	Het
Kcnb2	A	T	1: 15,781,716 (GRCm39)	I863F	probably benign	Het
Lamb1	T	C	12: 31,348,908 (GRCm39)	F647L	possibly damaging	Het
Mccc1	T	A	3: 36,030,891 (GRCm39)	M392L	probably benign	Het
Mtmr10	T	C	7: 63,938,149 (GRCm39)		probably null	Het
Ncstn	A	C	1: 171,900,406 (GRCm39)	V223G	possibly damaging	Het
Neurl3	G	T	1: 36,308,571 (GRCm39)	F80L	probably damaging	Het
Nf1	T	C	11: 79,334,785 (GRCm39)	M869T	possibly damaging	Het
Nfatc2	A	G	2: 168,376,810 (GRCm39)		probably benign	Het
Nnat	T	C	2: 157,403,137 (GRCm39)	F26S	possibly damaging	Het
Nos1ap	T	C	1: 170,202,820 (GRCm39)	Y109C	probably damaging	Het
Nup205	T	A	6: 35,166,124 (GRCm39)	D194E	probably damaging	Het
Or10ak11	T	A	4: 118,687,308 (GRCm39)	I109L	probably benign	Het
Or3a4	T	C	11: 73,944,803 (GRCm39)	S261G	probably benign	Het
Or52k2	C	T	7: 102,254,076 (GRCm39)	R172*	probably null	Het
Or5b109	A	T	19: 13,212,322 (GRCm39)	Q236L	probably benign	Het
Or9g3	A	T	2: 85,590,263 (GRCm39)	F152L	probably benign	Het
Ostf1	A	G	19: 18,558,677 (GRCm39)	L202S	probably benign	Het
Pdzrn4	T	A	15: 92,668,806 (GRCm39)	M747K	probably damaging	Het
Plxnb1	A	G	9: 108,935,521 (GRCm39)	D1019G	probably benign	Het
Pnlip	A	G	19: 58,661,595 (GRCm39)	I95V	probably benign	Het
Polr3a	T	C	14: 24,505,009 (GRCm39)	I1084V	possibly damaging	Het
Ppp1r13b	T	A	12: 111,805,122 (GRCm39)	T197S	probably benign	Het
Rasgrp3	A	T	17: 75,810,370 (GRCm39)	I357F	probably damaging	Het
Rbmxl2	G	C	7: 106,809,044 (GRCm39)	G110R	probably damaging	Het
Relch	C	T	1: 105,654,109 (GRCm39)	T826I	possibly damaging	Het
Rgs22	T	C	15: 36,015,773 (GRCm39)	D1037G	possibly damaging	Het
Rnf215	A	G	11: 4,085,843 (GRCm39)	I107M	probably benign	Het
Rybp	A	T	6: 100,264,231 (GRCm39)	M3K	probably damaging	Het
Sgo2b	T	C	8: 64,379,590 (GRCm39)	S1081G	possibly damaging	Het
Spag17	T	C	3: 99,963,468 (GRCm39)	V1062A	probably benign	Het
Sult2a1	A	T	7: 13,569,944 (GRCm39)	I96K	possibly damaging	Het
Tbc1d5	A	G	17: 51,042,995 (GRCm39)	I831T	probably damaging	Het
Thbs3	T	C	3: 89,130,692 (GRCm39)		probably benign	Het
Tmub2	T	C	11: 102,179,066 (GRCm39)	L255S	possibly damaging	Het
Trank1	T	A	9: 111,222,026 (GRCm39)	L2921Q	probably benign	Het
Trappc14	A	T	5: 138,259,260 (GRCm39)		probably null	Het
Tuba8	A	T	6: 121,203,060 (GRCm39)		probably benign	Het
Vmn2r25	T	C	6: 123,805,451 (GRCm39)	I469V	probably benign	Het
Zfp1007	A	T	5: 109,823,502 (GRCm39)	Y649*	probably null	Het

Other mutations in Slfn10-ps

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL00773:Slfn10-ps	APN	11	82,926,355 (GRCm39)	unclassified	noncoding transcript
IGL00826:Slfn10-ps	APN	11	82,926,085 (GRCm39)	unclassified	noncoding transcript
IGL01022:Slfn10-ps	APN	11	82,926,353 (GRCm39)	unclassified	noncoding transcript
IGL01409:Slfn10-ps	APN	11	82,926,322 (GRCm39)	unclassified	noncoding transcript
IGL01664:Slfn10-ps	APN	11	82,926,761 (GRCm39)	unclassified	noncoding transcript
IGL01700:Slfn10-ps	APN	11	82,919,938 (GRCm39)	unclassified	noncoding transcript
IGL02093:Slfn10-ps	APN	11	82,923,016 (GRCm39)	unclassified	noncoding transcript
IGL02253:Slfn10-ps	APN	11	82,919,890 (GRCm39)	unclassified	noncoding transcript
IGL02364:Slfn10-ps	APN	11	82,923,117 (GRCm39)	unclassified	noncoding transcript
IGL02466:Slfn10-ps	APN	11	82,921,090 (GRCm39)	unclassified	noncoding transcript
IGL02636:Slfn10-ps	APN	11	82,920,971 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0055:Slfn10-ps	UTSW	11	82,921,126 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0069:Slfn10-ps	UTSW	11	82,926,368 (GRCm39)	unclassified	noncoding transcript
R0164:Slfn10-ps	UTSW	11	82,926,128 (GRCm39)	unclassified	noncoding transcript
R0362:Slfn10-ps	UTSW	11	82,926,600 (GRCm39)	unclassified	noncoding transcript
R0382:Slfn10-ps	UTSW	11	82,920,360 (GRCm39)	unclassified	noncoding transcript
R0597:Slfn10-ps	UTSW	11	82,926,479 (GRCm39)	unclassified	noncoding transcript
R0812:Slfn10-ps	UTSW	11	82,926,388 (GRCm39)	unclassified	noncoding transcript
R0904:Slfn10-ps	UTSW	11	82,926,235 (GRCm39)	unclassified	noncoding transcript
R1552:Slfn10-ps	UTSW	11	82,920,676 (GRCm39)	unclassified	noncoding transcript
R1703:Slfn10-ps	UTSW	11	82,920,869 (GRCm39)	unclassified	noncoding transcript
R2127:Slfn10-ps	UTSW	11	82,921,168 (GRCm39)	unclassified	noncoding transcript
R2151:Slfn10-ps	UTSW	11	82,926,511 (GRCm39)	unclassified	noncoding transcript
R2302:Slfn10-ps	UTSW	11	82,919,756 (GRCm39)	unclassified	noncoding transcript
R3114:Slfn10-ps	UTSW	11	82,919,955 (GRCm39)	unclassified	noncoding transcript
R4293:Slfn10-ps	UTSW	11	82,926,260 (GRCm39)	unclassified	noncoding transcript
R4929:Slfn10-ps	UTSW	11	82,920,345 (GRCm39)	unclassified	noncoding transcript
R4970:Slfn10-ps	UTSW	11	82,921,207 (GRCm39)	unclassified	noncoding transcript
R5083:Slfn10-ps	UTSW	11	82,921,341 (GRCm39)	unclassified	noncoding transcript
R5290:Slfn10-ps	UTSW	11	82,919,851 (GRCm39)	unclassified	noncoding transcript
R5306:Slfn10-ps	UTSW	11	82,926,355 (GRCm39)	unclassified	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AAAGCCAACTTCAGTGGGTG -3'
(R):5'- AAACACCCAGGGAGGCTATC -3'

Sequencing Primer
(F):5'- CCAACTTCAGTGGGTGTAATGAACTC -3'
(R):5'- AACACCCAGGGAGGCTATCTTTTC -3'

Posted On

2016-09-01