Incidental Mutation 'R5444:Polr3a'
ID 427359
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Name polymerase (RNA) III (DNA directed) polypeptide A
Synonyms RPC155, 9330175N20Rik, RPC1
MMRRC Submission 043009-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5444 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 24498764-24537126 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24505009 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1084 (I1084V)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
AlphaFold B2RXC6
Predicted Effect possibly damaging
Transcript: ENSMUST00000026322
AA Change: I1084V

PolyPhen 2 Score 0.648 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: I1084V

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223848
Meta Mutation Damage Score 0.1175 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930584F24Rik A G 5: 26,684,735 (GRCm39) noncoding transcript Het
Adam11 A G 11: 102,663,674 (GRCm39) Q284R probably damaging Het
Adamts17 T A 7: 66,691,647 (GRCm39) H610Q probably benign Het
Alg6 A G 4: 99,629,816 (GRCm39) Y131C probably benign Het
Apol9b T C 15: 77,619,963 (GRCm39) I253T probably damaging Het
Asb4 T A 6: 5,431,040 (GRCm39) I425N probably damaging Het
Atic T C 1: 71,615,876 (GRCm39) L474P probably damaging Het
B3glct C T 5: 149,669,985 (GRCm39) T318I probably damaging Het
Bbs7 T C 3: 36,666,199 (GRCm39) K22E possibly damaging Het
Cdk17 T G 10: 93,053,823 (GRCm39) probably null Het
Cemip T A 7: 83,631,499 (GRCm39) T438S probably damaging Het
Chd2 T C 7: 73,122,833 (GRCm39) E967G probably damaging Het
Cyp2d26 G T 15: 82,676,739 (GRCm39) D202E probably benign Het
Dhdds G A 4: 133,698,447 (GRCm39) R295* probably null Het
Eef2kmt G A 16: 5,066,959 (GRCm39) probably benign Het
Fn3krp G A 11: 121,312,430 (GRCm39) probably null Het
Gjc3 G A 5: 137,955,809 (GRCm39) L159F probably damaging Het
Gm28434 T C 5: 88,127,147 (GRCm39) probably benign Het
Gp2 G A 7: 119,053,821 (GRCm39) P47S possibly damaging Het
Irf7 C T 7: 140,844,732 (GRCm39) probably benign Het
Itgb8 T C 12: 119,201,573 (GRCm39) probably benign Het
Kcnb2 A T 1: 15,781,716 (GRCm39) I863F probably benign Het
Lamb1 T C 12: 31,348,908 (GRCm39) F647L possibly damaging Het
Mccc1 T A 3: 36,030,891 (GRCm39) M392L probably benign Het
Mtmr10 T C 7: 63,938,149 (GRCm39) probably null Het
Ncstn A C 1: 171,900,406 (GRCm39) V223G possibly damaging Het
Neurl3 G T 1: 36,308,571 (GRCm39) F80L probably damaging Het
Nf1 T C 11: 79,334,785 (GRCm39) M869T possibly damaging Het
Nfatc2 A G 2: 168,376,810 (GRCm39) probably benign Het
Nnat T C 2: 157,403,137 (GRCm39) F26S possibly damaging Het
Nos1ap T C 1: 170,202,820 (GRCm39) Y109C probably damaging Het
Nup205 T A 6: 35,166,124 (GRCm39) D194E probably damaging Het
Or10ak11 T A 4: 118,687,308 (GRCm39) I109L probably benign Het
Or3a4 T C 11: 73,944,803 (GRCm39) S261G probably benign Het
Or52k2 C T 7: 102,254,076 (GRCm39) R172* probably null Het
Or5b109 A T 19: 13,212,322 (GRCm39) Q236L probably benign Het
Or9g3 A T 2: 85,590,263 (GRCm39) F152L probably benign Het
Ostf1 A G 19: 18,558,677 (GRCm39) L202S probably benign Het
Pdzrn4 T A 15: 92,668,806 (GRCm39) M747K probably damaging Het
Plxnb1 A G 9: 108,935,521 (GRCm39) D1019G probably benign Het
Pnlip A G 19: 58,661,595 (GRCm39) I95V probably benign Het
Ppp1r13b T A 12: 111,805,122 (GRCm39) T197S probably benign Het
Rasgrp3 A T 17: 75,810,370 (GRCm39) I357F probably damaging Het
Rbmxl2 G C 7: 106,809,044 (GRCm39) G110R probably damaging Het
Relch C T 1: 105,654,109 (GRCm39) T826I possibly damaging Het
Rgs22 T C 15: 36,015,773 (GRCm39) D1037G possibly damaging Het
Rnf215 A G 11: 4,085,843 (GRCm39) I107M probably benign Het
Rybp A T 6: 100,264,231 (GRCm39) M3K probably damaging Het
Sgo2b T C 8: 64,379,590 (GRCm39) S1081G possibly damaging Het
Slfn10-ps C T 11: 82,926,113 (GRCm39) noncoding transcript Het
Spag17 T C 3: 99,963,468 (GRCm39) V1062A probably benign Het
Sult2a1 A T 7: 13,569,944 (GRCm39) I96K possibly damaging Het
Tbc1d5 A G 17: 51,042,995 (GRCm39) I831T probably damaging Het
Thbs3 T C 3: 89,130,692 (GRCm39) probably benign Het
Tmub2 T C 11: 102,179,066 (GRCm39) L255S possibly damaging Het
Trank1 T A 9: 111,222,026 (GRCm39) L2921Q probably benign Het
Trappc14 A T 5: 138,259,260 (GRCm39) probably null Het
Tuba8 A T 6: 121,203,060 (GRCm39) probably benign Het
Vmn2r25 T C 6: 123,805,451 (GRCm39) I469V probably benign Het
Zfp1007 A T 5: 109,823,502 (GRCm39) Y649* probably null Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24,525,931 (GRCm39) missense probably benign 0.35
IGL00974:Polr3a APN 14 24,529,492 (GRCm39) missense probably benign 0.05
IGL01348:Polr3a APN 14 24,511,831 (GRCm39) missense probably damaging 1.00
IGL01464:Polr3a APN 14 24,520,749 (GRCm39) splice site probably benign
IGL01785:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01786:Polr3a APN 14 24,534,188 (GRCm39) nonsense probably null
IGL01936:Polr3a APN 14 24,529,256 (GRCm39) missense probably damaging 1.00
IGL02095:Polr3a APN 14 24,504,678 (GRCm39) missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24,525,891 (GRCm39) missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24,520,945 (GRCm39) missense probably benign 0.07
IGL02961:Polr3a APN 14 24,517,108 (GRCm39) nonsense probably null
IGL03069:Polr3a APN 14 24,511,808 (GRCm39) missense probably damaging 0.99
R0001:Polr3a UTSW 14 24,502,257 (GRCm39) splice site probably benign
R0048:Polr3a UTSW 14 24,519,323 (GRCm39) splice site probably benign
R0157:Polr3a UTSW 14 24,529,254 (GRCm39) missense probably damaging 0.99
R0445:Polr3a UTSW 14 24,504,989 (GRCm39) missense probably benign 0.00
R0449:Polr3a UTSW 14 24,534,534 (GRCm39) missense probably damaging 0.99
R0597:Polr3a UTSW 14 24,534,202 (GRCm39) missense probably benign 0.29
R0604:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0644:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0703:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0754:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0767:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0816:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0817:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0819:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R0840:Polr3a UTSW 14 24,502,268 (GRCm39) missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24,502,616 (GRCm39) missense probably null 0.98
R1644:Polr3a UTSW 14 24,520,692 (GRCm39) missense probably damaging 1.00
R1699:Polr3a UTSW 14 24,534,232 (GRCm39) missense probably damaging 1.00
R1704:Polr3a UTSW 14 24,534,188 (GRCm39) nonsense probably null
R2363:Polr3a UTSW 14 24,525,960 (GRCm39) splice site probably null
R3419:Polr3a UTSW 14 24,517,103 (GRCm39) missense probably damaging 1.00
R3934:Polr3a UTSW 14 24,526,169 (GRCm39) missense probably benign 0.30
R4296:Polr3a UTSW 14 24,503,264 (GRCm39) missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24,502,576 (GRCm39) splice site probably null
R4690:Polr3a UTSW 14 24,514,349 (GRCm39) missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24,502,692 (GRCm39) missense probably benign 0.11
R4947:Polr3a UTSW 14 24,532,532 (GRCm39) missense probably benign 0.00
R5232:Polr3a UTSW 14 24,503,279 (GRCm39) missense probably benign 0.00
R5263:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24,505,009 (GRCm39) missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24,515,455 (GRCm39) splice site probably null
R5841:Polr3a UTSW 14 24,500,766 (GRCm39) missense probably benign 0.00
R6408:Polr3a UTSW 14 24,536,939 (GRCm39) critical splice donor site probably null
R6704:Polr3a UTSW 14 24,511,910 (GRCm39) missense probably damaging 1.00
R7136:Polr3a UTSW 14 24,511,883 (GRCm39) missense probably damaging 1.00
R7307:Polr3a UTSW 14 24,510,055 (GRCm39) missense probably benign 0.03
R7368:Polr3a UTSW 14 24,517,144 (GRCm39) missense probably damaging 0.98
R7800:Polr3a UTSW 14 24,534,455 (GRCm39) missense probably null 0.83
R8753:Polr3a UTSW 14 24,513,702 (GRCm39) nonsense probably null
R8785:Polr3a UTSW 14 24,502,383 (GRCm39) missense probably benign 0.06
R8848:Polr3a UTSW 14 24,500,834 (GRCm39) missense probably damaging 1.00
R9025:Polr3a UTSW 14 24,519,479 (GRCm39) missense probably damaging 1.00
R9139:Polr3a UTSW 14 24,519,416 (GRCm39) missense probably damaging 1.00
R9264:Polr3a UTSW 14 24,520,899 (GRCm39) missense probably benign
R9309:Polr3a UTSW 14 24,510,067 (GRCm39) missense probably benign
R9363:Polr3a UTSW 14 24,500,831 (GRCm39) missense probably damaging 1.00
R9526:Polr3a UTSW 14 24,503,313 (GRCm39) missense probably benign 0.00
R9585:Polr3a UTSW 14 24,502,289 (GRCm39) missense probably damaging 1.00
Z1088:Polr3a UTSW 14 24,529,792 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCATTACCCGCACTGTCATGG -3'
(R):5'- TCAGTGAGAGGTCTGTGACG -3'

Sequencing Primer
(F):5'- GCTGCAGGCTACATCCACAG -3'
(R):5'- AGAGGTCTGTGACGTCCCTTG -3'
Posted On 2016-09-01