Incidental Mutation 'R5445:Spdye4c'
ID427381
Institutional Source Beutler Lab
Gene Symbol Spdye4c
Ensembl Gene ENSMUSG00000074812
Gene Namespeedy/RINGO cell cycle regulator family, member E4C
SynonymsGm355, LOC241634
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location128591209-128598464 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 128596564 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 281 (Q281*)
Ref Sequence ENSEMBL: ENSMUSP00000135991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144559] [ENSMUST00000155430] [ENSMUST00000178601]
Predicted Effect probably null
Transcript: ENSMUST00000144559
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000140478
Gene: ENSMUSG00000074812
AA Change: Q281*

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Pfam:Spy1 204 335 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155430
SMART Domains Protein: ENSMUSP00000117916
Gene: ENSMUSG00000074812

DomainStartEndE-ValueType
low complexity region 87 99 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178601
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000135991
Gene: ENSMUSG00000074812
AA Change: Q281*

DomainStartEndE-ValueType
Pfam:Spy1 37 168 1.3e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Spdye4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Spdye4c APN 2 128592666 missense possibly damaging 0.89
R0616:Spdye4c UTSW 2 128594212 missense possibly damaging 0.94
R1072:Spdye4c UTSW 2 128596637 missense probably benign 0.02
R1455:Spdye4c UTSW 2 128596558 missense probably damaging 1.00
R1545:Spdye4c UTSW 2 128595712 missense probably benign 0.03
R1682:Spdye4c UTSW 2 128592622 missense probably damaging 0.96
R4668:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R4669:Spdye4c UTSW 2 128592353 missense possibly damaging 0.46
R5287:Spdye4c UTSW 2 128592640 missense possibly damaging 0.83
R5613:Spdye4c UTSW 2 128592969 missense possibly damaging 0.72
R5629:Spdye4c UTSW 2 128596785 missense probably damaging 1.00
R5786:Spdye4c UTSW 2 128596841 makesense probably null
R5911:Spdye4c UTSW 2 128596074 nonsense probably null
R5912:Spdye4c UTSW 2 128596074 nonsense probably null
R6008:Spdye4c UTSW 2 128596633 missense probably benign 0.00
R6817:Spdye4c UTSW 2 128596510 missense probably damaging 1.00
R6856:Spdye4c UTSW 2 128596130 splice site probably null
R7402:Spdye4c UTSW 2 128592341 start codon destroyed probably benign 0.08
R7677:Spdye4c UTSW 2 128594136 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTAAATGGGCTCTGTGTCC -3'
(R):5'- GAACCCATCCATGGTCTTCC -3'

Sequencing Primer
(F):5'- TCTGTGTCCAGGATGCCC -3'
(R):5'- ATGGTCTTCCCTGGGCAG -3'
Posted On2016-09-01