Incidental Mutation 'R5445:Pdlim5'
ID427385
Institutional Source Beutler Lab
Gene Symbol Pdlim5
Ensembl Gene ENSMUSG00000028273
Gene NamePDZ and LIM domain 5
SynonymsEnh3, Enh, Enh2, 1110001A05Rik
MMRRC Submission 043010-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location142239590-142395696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 142352734 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 83 (R83K)
Ref Sequence ENSEMBL: ENSMUSP00000143098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029941] [ENSMUST00000058626] [ENSMUST00000090134] [ENSMUST00000168967] [ENSMUST00000170361] [ENSMUST00000195975] [ENSMUST00000196220] [ENSMUST00000196908] [ENSMUST00000198381] [ENSMUST00000200043]
Predicted Effect probably null
Transcript: ENSMUST00000029941
AA Change: R83K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029941
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Pfam:DUF4749 212 305 1.3e-9 PFAM
low complexity region 310 339 N/A INTRINSIC
LIM 414 465 3.17e-17 SMART
LIM 473 524 4.62e-19 SMART
LIM 532 585 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000058626
AA Change: R83K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059267
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000090134
AA Change: R83K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087595
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 111 118 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168967
AA Change: R83K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132647
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170361
AA Change: R83K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000128752
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
Pfam:DUF4749 101 207 2.7e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000195975
AA Change: R83K

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142737
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 237 246 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
low complexity region 333 362 N/A INTRINSIC
LIM 437 488 3.17e-17 SMART
LIM 496 547 4.62e-19 SMART
LIM 555 608 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196220
AA Change: R83K

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142460
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 276 291 N/A INTRINSIC
low complexity region 293 322 N/A INTRINSIC
LIM 397 448 3.17e-17 SMART
LIM 456 507 4.62e-19 SMART
LIM 515 568 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000196908
AA Change: R83K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143098
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 144 171 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000198381
AA Change: R83K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142899
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 201 230 N/A INTRINSIC
LIM 305 356 3.17e-17 SMART
LIM 364 415 4.62e-19 SMART
LIM 423 476 1.79e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200043
AA Change: R83K

PolyPhen 2 Score 0.268 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143343
Gene: ENSMUSG00000028273
AA Change: R83K

DomainStartEndE-ValueType
PDZ 12 85 5.54e-17 SMART
low complexity region 228 243 N/A INTRINSIC
low complexity region 245 274 N/A INTRINSIC
LIM 349 400 3.17e-17 SMART
LIM 408 459 4.62e-19 SMART
LIM 467 520 1.79e-16 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that possess a 100-amino acid PDZ domain at the N terminus and one to three LIM domains at the C-terminus. This family member functions as a scaffold protein that tethers protein kinases to the Z-disk in striated muscles. It is thought to function in cardiomyocyte expansion and in restraining postsynaptic growth of excitatory synapses. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired cardiac muscle contractility, wider Z-lines, and dilated cardiomyopathy. Mice heterozygous for a gene trap allele exhibit impaired response to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Zfp786 T C 6: 47,819,685 E773G probably damaging Het
Other mutations in Pdlim5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Pdlim5 APN 3 142352787 missense probably damaging 1.00
R1868:Pdlim5 UTSW 3 142306299 critical splice acceptor site probably null
R1937:Pdlim5 UTSW 3 142244981 missense possibly damaging 0.46
R3000:Pdlim5 UTSW 3 142312131 missense probably damaging 1.00
R4477:Pdlim5 UTSW 3 142259217 missense probably benign 0.09
R4959:Pdlim5 UTSW 3 142311979 intron probably benign
R4973:Pdlim5 UTSW 3 142311979 intron probably benign
R5135:Pdlim5 UTSW 3 142304365 missense probably benign 0.34
R5393:Pdlim5 UTSW 3 142259186 missense probably damaging 1.00
R5707:Pdlim5 UTSW 3 142304299 missense probably damaging 1.00
R6154:Pdlim5 UTSW 3 142277913 missense possibly damaging 0.68
R6269:Pdlim5 UTSW 3 142312325 missense possibly damaging 0.57
R6395:Pdlim5 UTSW 3 142314422 missense probably damaging 1.00
R6600:Pdlim5 UTSW 3 142259278 missense probably damaging 1.00
R6911:Pdlim5 UTSW 3 142304315 missense probably damaging 0.98
R7135:Pdlim5 UTSW 3 142311922 intron probably null
R7283:Pdlim5 UTSW 3 142311980 critical splice acceptor site probably null
R7334:Pdlim5 UTSW 3 142244917 missense probably damaging 1.00
R7660:Pdlim5 UTSW 3 142259185 missense probably damaging 1.00
R7687:Pdlim5 UTSW 3 142277847 missense probably benign 0.02
R7696:Pdlim5 UTSW 3 142277862 missense probably benign 0.08
R7779:Pdlim5 UTSW 3 142242686 missense probably benign 0.27
R7904:Pdlim5 UTSW 3 142312393 missense probably damaging 1.00
R7987:Pdlim5 UTSW 3 142312393 missense probably damaging 1.00
R8171:Pdlim5 UTSW 3 142312187 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAGCTCTAGTGAGAAACTTTTCAG -3'
(R):5'- ACAGTGAGGTTTCTAATGAGATCTG -3'

Sequencing Primer
(F):5'- CGACCAATGTTTATGAAGACATGG -3'
(R):5'- AGATCTGTTTATTGCAGCTGAAG -3'
Posted On2016-09-01