Incidental Mutation 'R5445:Nwd2'
ID 427393
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene Name NACHT and WD repeat domain containing 2
Synonyms 3110047P20Rik, B830017A01Rik
MMRRC Submission 043010-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.119) question?
Stock # R5445 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 63806446-63967889 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63962681 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 755 (M755T)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584] [ENSMUST00000162166]
AlphaFold Q6P5U7
Predicted Effect probably damaging
Transcript: ENSMUST00000159584
AA Change: M755T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: M755T

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162166
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg5 A T 17: 84,978,557 (GRCm39) D300E probably damaging Het
Apbb1ip T C 2: 22,725,960 (GRCm39) V244A possibly damaging Het
Arhgap32 T C 9: 32,159,678 (GRCm39) S232P probably benign Het
Atf7ip G A 6: 136,564,255 (GRCm39) V833M probably damaging Het
Casp7 A G 19: 56,421,770 (GRCm39) probably null Het
Ccdc9b T C 2: 118,590,067 (GRCm39) D259G probably damaging Het
Celsr2 T A 3: 108,299,974 (GRCm39) E2911D probably benign Het
Cep350 T C 1: 155,770,469 (GRCm39) D1807G probably benign Het
Cfap251 C T 5: 123,425,240 (GRCm39) T294M probably damaging Het
Chrd A G 16: 20,557,660 (GRCm39) T753A possibly damaging Het
Clasp2 A G 9: 113,733,014 (GRCm39) D971G probably damaging Het
Cnnm2 A G 19: 46,865,727 (GRCm39) T772A possibly damaging Het
Cntn1 A T 15: 92,192,958 (GRCm39) N687Y probably damaging Het
Col6a3 G A 1: 90,709,761 (GRCm39) R1812* probably null Het
Dsc2 T C 18: 20,168,360 (GRCm39) I700V possibly damaging Het
Flt3 G A 5: 147,291,905 (GRCm39) Q540* probably null Het
Fmo4 T A 1: 162,632,842 (GRCm39) I170F probably benign Het
Fra10ac1 T A 19: 38,207,910 (GRCm39) D72V possibly damaging Het
Garin2 G A 12: 78,761,890 (GRCm39) E185K probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Gm2381 T G 7: 42,469,425 (GRCm39) H233P probably damaging Het
Gm5148 T A 3: 37,768,995 (GRCm39) Q75L probably damaging Het
Gm8369 T C 19: 11,482,170 (GRCm39) V27A possibly damaging Het
Gpr157 T C 4: 150,186,825 (GRCm39) S318P probably benign Het
Hectd4 G A 5: 121,404,337 (GRCm39) V405M probably benign Het
Hemgn T C 4: 46,400,738 (GRCm39) R41G probably benign Het
Hhipl1 T A 12: 108,294,467 (GRCm39) L791Q probably damaging Het
Hjurp T G 1: 88,194,038 (GRCm39) K290T probably benign Het
Ifi207 T C 1: 173,555,363 (GRCm39) E773G probably damaging Het
Kcnh6 T C 11: 105,914,685 (GRCm39) Y697H probably damaging Het
Lonrf2 T C 1: 38,846,234 (GRCm39) T313A probably benign Het
Lrba G T 3: 86,275,902 (GRCm39) V1757L probably benign Het
Lrrc24 T C 15: 76,600,306 (GRCm39) T278A probably benign Het
Ltbp2 T C 12: 84,856,428 (GRCm39) I679V probably null Het
Mapk4 G T 18: 74,064,073 (GRCm39) T383K probably benign Het
Mdn1 C T 4: 32,723,690 (GRCm39) P2542L probably damaging Het
Mia3 A G 1: 183,117,471 (GRCm39) V208A probably benign Het
Myo15a C A 11: 60,411,603 (GRCm39) C3234* probably null Het
Nlrp1b G T 11: 71,108,701 (GRCm39) Q267K probably benign Het
Nphp3 A G 9: 103,881,922 (GRCm39) K37E probably damaging Het
Or10u4 T A 10: 129,802,158 (GRCm39) H137L probably benign Het
Or52ac1 A G 7: 104,246,028 (GRCm39) F120S probably damaging Het
Or5p58 A G 7: 107,693,949 (GRCm39) V276A possibly damaging Het
Pdlim5 C T 3: 142,058,495 (GRCm39) R83K probably null Het
Plekha5 A T 6: 140,498,459 (GRCm39) R173* probably null Het
Pramel25 T A 4: 143,521,707 (GRCm39) V441E possibly damaging Het
Rbms3 T A 9: 117,080,853 (GRCm39) D6V possibly damaging Het
Rhoq A T 17: 87,271,755 (GRCm39) Y57F probably benign Het
Rrm1 A T 7: 102,100,230 (GRCm39) T204S possibly damaging Het
Slf1 A T 13: 77,239,323 (GRCm39) I447N probably benign Het
Smarcc2 T A 10: 128,323,943 (GRCm39) probably benign Het
Spdye4c C T 2: 128,438,484 (GRCm39) Q281* probably null Het
Tert T A 13: 73,792,403 (GRCm39) M890K probably benign Het
Tln1 C A 4: 43,543,905 (GRCm39) R1198L probably benign Het
Tmco4 A G 4: 138,748,178 (GRCm39) M253V probably damaging Het
Usp19 G T 9: 108,375,119 (GRCm39) V782F possibly damaging Het
Usp33 T A 3: 152,080,260 (GRCm39) S464T probably damaging Het
Usp47 A T 7: 111,673,928 (GRCm39) Y397F probably damaging Het
Vmn1r12 A G 6: 57,136,466 (GRCm39) T144A probably benign Het
Vmn2r90 A T 17: 17,954,386 (GRCm39) H850L probably benign Het
Zfhx3 A T 8: 109,682,842 (GRCm39) Q3427L unknown Het
Zfp236 G T 18: 82,700,281 (GRCm39) Q63K probably benign Het
Zfp7 T A 15: 76,775,054 (GRCm39) C365* probably null Het
Zfp786 T C 6: 47,796,619 (GRCm39) E773G probably damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63,962,818 (GRCm39) missense probably benign
IGL01111:Nwd2 APN 5 63,964,643 (GRCm39) missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63,963,872 (GRCm39) missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63,965,626 (GRCm39) missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63,962,937 (GRCm39) missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63,964,153 (GRCm39) missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63,961,938 (GRCm39) missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63,962,042 (GRCm39) missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63,948,996 (GRCm39) splice site probably null
IGL02184:Nwd2 APN 5 63,963,020 (GRCm39) missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63,962,644 (GRCm39) missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63,962,570 (GRCm39) missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63,965,512 (GRCm39) missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63,962,021 (GRCm39) missense probably damaging 1.00
IGL02682:Nwd2 APN 5 63,962,020 (GRCm39) missense probably benign 0.03
IGL02891:Nwd2 APN 5 63,882,570 (GRCm39) missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63,963,338 (GRCm39) missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63,963,338 (GRCm39) missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63,965,241 (GRCm39) missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63,963,712 (GRCm39) missense probably benign 0.44
R0196:Nwd2 UTSW 5 63,963,694 (GRCm39) missense probably benign 0.37
R0239:Nwd2 UTSW 5 63,957,467 (GRCm39) missense probably benign 0.01
R0239:Nwd2 UTSW 5 63,957,467 (GRCm39) missense probably benign 0.01
R0309:Nwd2 UTSW 5 63,964,561 (GRCm39) missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63,962,341 (GRCm39) missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63,962,116 (GRCm39) missense probably benign 0.00
R0384:Nwd2 UTSW 5 63,963,025 (GRCm39) missense probably benign 0.11
R0496:Nwd2 UTSW 5 63,963,686 (GRCm39) missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63,963,686 (GRCm39) missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63,963,686 (GRCm39) missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63,962,454 (GRCm39) missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63,948,928 (GRCm39) missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63,957,757 (GRCm39) missense probably benign 0.33
R0835:Nwd2 UTSW 5 63,957,473 (GRCm39) missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63,965,234 (GRCm39) missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63,964,655 (GRCm39) missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63,964,154 (GRCm39) missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63,963,917 (GRCm39) missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63,807,367 (GRCm39) utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63,902,540 (GRCm39) missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63,964,318 (GRCm39) missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63,957,525 (GRCm39) missense probably benign 0.00
R1553:Nwd2 UTSW 5 63,957,848 (GRCm39) missense probably benign 0.00
R1636:Nwd2 UTSW 5 63,964,900 (GRCm39) missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63,964,589 (GRCm39) missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63,965,614 (GRCm39) missense probably benign
R1800:Nwd2 UTSW 5 63,962,917 (GRCm39) missense probably benign 0.15
R1813:Nwd2 UTSW 5 63,962,753 (GRCm39) missense probably benign 0.00
R1861:Nwd2 UTSW 5 63,962,197 (GRCm39) missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63,965,009 (GRCm39) missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63,962,753 (GRCm39) missense probably benign 0.00
R1919:Nwd2 UTSW 5 63,963,523 (GRCm39) missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63,951,585 (GRCm39) missense probably benign
R2258:Nwd2 UTSW 5 63,962,499 (GRCm39) missense probably benign 0.00
R2292:Nwd2 UTSW 5 63,962,917 (GRCm39) missense probably benign 0.15
R2504:Nwd2 UTSW 5 63,961,717 (GRCm39) missense probably benign 0.02
R2869:Nwd2 UTSW 5 63,957,671 (GRCm39) missense probably benign 0.00
R2869:Nwd2 UTSW 5 63,957,671 (GRCm39) missense probably benign 0.00
R2958:Nwd2 UTSW 5 63,963,325 (GRCm39) missense probably benign 0.01
R3034:Nwd2 UTSW 5 63,957,446 (GRCm39) missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63,882,536 (GRCm39) missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63,957,504 (GRCm39) missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63,961,895 (GRCm39) missense probably benign 0.00
R4193:Nwd2 UTSW 5 63,964,808 (GRCm39) missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63,963,889 (GRCm39) missense possibly damaging 0.74
R4384:Nwd2 UTSW 5 63,963,914 (GRCm39) missense probably damaging 1.00
R4707:Nwd2 UTSW 5 63,951,665 (GRCm39) missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63,961,803 (GRCm39) missense probably benign 0.00
R4735:Nwd2 UTSW 5 63,965,594 (GRCm39) missense probably benign 0.34
R4744:Nwd2 UTSW 5 63,964,310 (GRCm39) missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63,962,776 (GRCm39) missense probably benign 0.21
R4835:Nwd2 UTSW 5 63,965,189 (GRCm39) missense probably benign 0.00
R4839:Nwd2 UTSW 5 63,962,893 (GRCm39) missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63,962,151 (GRCm39) missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63,807,484 (GRCm39) utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63,963,380 (GRCm39) missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63,963,415 (GRCm39) nonsense probably null
R5330:Nwd2 UTSW 5 63,963,859 (GRCm39) missense probably benign 0.02
R5331:Nwd2 UTSW 5 63,963,859 (GRCm39) missense probably benign 0.02
R5419:Nwd2 UTSW 5 63,965,051 (GRCm39) missense probably benign 0.11
R5434:Nwd2 UTSW 5 63,964,991 (GRCm39) missense probably benign 0.00
R5761:Nwd2 UTSW 5 63,882,573 (GRCm39) missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63,965,114 (GRCm39) missense probably benign 0.00
R5907:Nwd2 UTSW 5 63,963,326 (GRCm39) missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63,965,413 (GRCm39) missense probably benign 0.32
R6002:Nwd2 UTSW 5 63,962,143 (GRCm39) missense probably benign
R6027:Nwd2 UTSW 5 63,965,563 (GRCm39) missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63,962,374 (GRCm39) missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63,963,131 (GRCm39) missense probably benign 0.00
R6172:Nwd2 UTSW 5 63,964,249 (GRCm39) missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63,957,596 (GRCm39) missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63,964,898 (GRCm39) missense probably benign 0.41
R6649:Nwd2 UTSW 5 63,882,527 (GRCm39) missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63,961,794 (GRCm39) missense probably benign 0.00
R7034:Nwd2 UTSW 5 63,962,258 (GRCm39) missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63,964,837 (GRCm39) missense probably benign 0.04
R7326:Nwd2 UTSW 5 63,957,752 (GRCm39) missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63,964,434 (GRCm39) nonsense probably null
R7576:Nwd2 UTSW 5 63,964,736 (GRCm39) missense probably benign 0.00
R7580:Nwd2 UTSW 5 63,965,624 (GRCm39) missense probably benign 0.05
R7723:Nwd2 UTSW 5 63,965,347 (GRCm39) missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63,961,847 (GRCm39) missense probably damaging 0.99
R8293:Nwd2 UTSW 5 63,962,663 (GRCm39) missense probably benign 0.05
R8517:Nwd2 UTSW 5 63,948,925 (GRCm39) missense probably damaging 1.00
R8782:Nwd2 UTSW 5 63,882,540 (GRCm39) missense probably damaging 1.00
R8792:Nwd2 UTSW 5 63,963,047 (GRCm39) missense probably damaging 0.97
R8888:Nwd2 UTSW 5 63,963,241 (GRCm39) missense probably damaging 1.00
R8895:Nwd2 UTSW 5 63,963,241 (GRCm39) missense probably damaging 1.00
R8901:Nwd2 UTSW 5 63,963,685 (GRCm39) missense probably damaging 1.00
R8913:Nwd2 UTSW 5 63,963,440 (GRCm39) missense possibly damaging 0.80
R8920:Nwd2 UTSW 5 63,948,863 (GRCm39) missense probably damaging 1.00
R9052:Nwd2 UTSW 5 63,961,773 (GRCm39) missense probably damaging 1.00
R9362:Nwd2 UTSW 5 63,961,747 (GRCm39) missense probably benign 0.23
R9368:Nwd2 UTSW 5 63,962,306 (GRCm39) missense probably damaging 0.99
R9377:Nwd2 UTSW 5 63,957,740 (GRCm39) missense probably damaging 1.00
R9430:Nwd2 UTSW 5 63,964,665 (GRCm39) missense probably damaging 1.00
R9655:Nwd2 UTSW 5 63,964,568 (GRCm39) nonsense probably null
R9661:Nwd2 UTSW 5 63,957,780 (GRCm39) missense probably damaging 0.97
R9736:Nwd2 UTSW 5 63,951,600 (GRCm39) missense probably damaging 1.00
R9793:Nwd2 UTSW 5 63,964,232 (GRCm39) missense probably damaging 1.00
R9795:Nwd2 UTSW 5 63,964,232 (GRCm39) missense probably damaging 1.00
RF020:Nwd2 UTSW 5 63,963,066 (GRCm39) nonsense probably null
X0023:Nwd2 UTSW 5 63,964,306 (GRCm39) missense probably damaging 0.99
Z1176:Nwd2 UTSW 5 63,963,500 (GRCm39) missense probably damaging 1.00
Z1176:Nwd2 UTSW 5 63,882,540 (GRCm39) missense probably damaging 1.00
Z1177:Nwd2 UTSW 5 63,964,669 (GRCm39) nonsense probably null
Z1177:Nwd2 UTSW 5 63,962,327 (GRCm39) missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- AGCAATCCCCTGAGAGTACC -3'
(R):5'- CAGACATCTTCCGGTGATTGAC -3'

Sequencing Primer
(F):5'- GTACCTTACCTGTATATTGCAAGGC -3'
(R):5'- TGGGTTACACTGGAAAACCC -3'
Posted On 2016-09-01