Incidental Mutation 'R5445:Zfp786'
ID427397
Institutional Source Beutler Lab
Gene Symbol Zfp786
Ensembl Gene ENSMUSG00000051499
Gene Namezinc finger protein 786
SynonymsA730012O14Rik
MMRRC Submission 043010-MU
Accession Numbers

Genbank: NM_177882; MGI: 3026883

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5445 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location47819266-47830867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47819685 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 773 (E773G)
Ref Sequence ENSEMBL: ENSMUSP00000057495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058844]
Predicted Effect probably damaging
Transcript: ENSMUST00000058844
AA Change: E773G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057495
Gene: ENSMUSG00000051499
AA Change: E773G

DomainStartEndE-ValueType
KRAB 9 69 2.6e-22 SMART
low complexity region 156 164 N/A INTRINSIC
ZnF_C2H2 240 262 5.34e-1 SMART
ZnF_C2H2 268 295 1.41e2 SMART
ZnF_C2H2 420 440 1.21e2 SMART
ZnF_C2H2 448 470 3.52e-1 SMART
ZnF_C2H2 476 498 1.89e-1 SMART
ZnF_C2H2 504 526 1.69e-3 SMART
ZnF_C2H2 532 554 5.59e-4 SMART
ZnF_C2H2 560 582 4.79e-3 SMART
ZnF_C2H2 588 610 3.69e-4 SMART
ZnF_C2H2 616 638 3.63e-3 SMART
ZnF_C2H2 644 665 5.92e0 SMART
ZnF_C2H2 671 693 2.57e-3 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 1.45e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000080603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143979
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430105I19Rik T C 2: 118,759,586 D259G probably damaging Het
Abcg5 A T 17: 84,671,129 D300E probably damaging Het
Apbb1ip T C 2: 22,835,948 V244A possibly damaging Het
Arhgap32 T C 9: 32,248,382 S232P probably benign Het
Atf7ip G A 6: 136,587,257 V833M probably damaging Het
Casp7 A G 19: 56,433,338 probably null Het
Celsr2 T A 3: 108,392,658 E2911D probably benign Het
Cep350 T C 1: 155,894,723 D1807G probably benign Het
Chrd A G 16: 20,738,910 T753A possibly damaging Het
Clasp2 A G 9: 113,903,946 D971G probably damaging Het
Cnnm2 A G 19: 46,877,288 T772A possibly damaging Het
Cntn1 A T 15: 92,295,077 N687Y probably damaging Het
Col6a3 G A 1: 90,782,039 R1812* probably null Het
Dsc2 T C 18: 20,035,303 I700V possibly damaging Het
Fam71d G A 12: 78,715,116 E185K probably damaging Het
Flt3 G A 5: 147,355,095 Q540* probably null Het
Fmo4 T A 1: 162,805,273 I170F probably benign Het
Fra10ac1 T A 19: 38,219,462 D72V possibly damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm13023 T A 4: 143,795,137 V441E possibly damaging Het
Gm2381 T G 7: 42,820,001 H233P probably damaging Het
Gm5148 T A 3: 37,714,846 Q75L probably damaging Het
Gm8369 T C 19: 11,504,806 V27A possibly damaging Het
Gpr157 T C 4: 150,102,368 S318P probably benign Het
Hectd4 G A 5: 121,266,274 V405M probably benign Het
Hemgn T C 4: 46,400,738 R41G probably benign Het
Hhipl1 T A 12: 108,328,208 L791Q probably damaging Het
Hjurp T G 1: 88,266,316 K290T probably benign Het
Ifi207 T C 1: 173,727,797 E773G probably damaging Het
Kcnh6 T C 11: 106,023,859 Y697H probably damaging Het
Lonrf2 T C 1: 38,807,153 T313A probably benign Het
Lrba G T 3: 86,368,595 V1757L probably benign Het
Lrrc24 T C 15: 76,716,106 T278A probably benign Het
Ltbp2 T C 12: 84,809,654 I679V probably null Het
Mapk4 G T 18: 73,931,002 T383K probably benign Het
Mdn1 C T 4: 32,723,690 P2542L probably damaging Het
Mia3 A G 1: 183,336,022 V208A probably benign Het
Myo15 C A 11: 60,520,777 C3234* probably null Het
Nlrp1b G T 11: 71,217,875 Q267K probably benign Het
Nphp3 A G 9: 104,004,723 K37E probably damaging Het
Nwd2 T C 5: 63,805,338 M755T probably damaging Het
Olfr482 A G 7: 108,094,742 V276A possibly damaging Het
Olfr655 A G 7: 104,596,821 F120S probably damaging Het
Olfr819 T A 10: 129,966,289 H137L probably benign Het
Pdlim5 C T 3: 142,352,734 R83K probably null Het
Plekha5 A T 6: 140,552,733 R173* probably null Het
Rbms3 T A 9: 117,251,785 D6V possibly damaging Het
Rhoq A T 17: 86,964,327 Y57F probably benign Het
Rrm1 A T 7: 102,451,023 T204S possibly damaging Het
Slf1 A T 13: 77,091,204 I447N probably benign Het
Smarcc2 T A 10: 128,488,074 probably benign Het
Spdye4c C T 2: 128,596,564 Q281* probably null Het
Tert T A 13: 73,644,284 M890K probably benign Het
Tln1 C A 4: 43,543,905 R1198L probably benign Het
Tmco4 A G 4: 139,020,867 M253V probably damaging Het
Usp19 G T 9: 108,497,920 V782F possibly damaging Het
Usp33 T A 3: 152,374,623 S464T probably damaging Het
Usp47 A T 7: 112,074,721 Y397F probably damaging Het
Vmn1r12 A G 6: 57,159,481 T144A probably benign Het
Vmn2r90 A T 17: 17,734,124 H850L probably benign Het
Wdr66 C T 5: 123,287,177 T294M probably damaging Het
Zfhx3 A T 8: 108,956,210 Q3427L unknown Het
Zfp236 G T 18: 82,682,156 Q63K probably benign Het
Zfp7 T A 15: 76,890,854 C365* probably null Het
Other mutations in Zfp786
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Zfp786 APN 6 47819671 makesense probably null
IGL02442:Zfp786 APN 6 47821367 missense probably benign 0.00
IGL02674:Zfp786 APN 6 47820493 missense probably benign 0.22
IGL02814:Zfp786 APN 6 47819841 missense probably damaging 1.00
IGL03072:Zfp786 APN 6 47821243 missense probably benign 0.01
IGL03294:Zfp786 APN 6 47821324 nonsense probably null
IGL03393:Zfp786 APN 6 47821524 missense possibly damaging 0.88
3-1:Zfp786 UTSW 6 47820445 missense probably damaging 1.00
PIT4581001:Zfp786 UTSW 6 47819822 missense probably damaging 1.00
R1071:Zfp786 UTSW 6 47821305 missense possibly damaging 0.91
R1426:Zfp786 UTSW 6 47825079 missense probably benign 0.17
R1976:Zfp786 UTSW 6 47819757 missense probably damaging 1.00
R2114:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2115:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2117:Zfp786 UTSW 6 47826997 missense probably damaging 1.00
R2176:Zfp786 UTSW 6 47820971 missense possibly damaging 0.65
R2304:Zfp786 UTSW 6 47820699 missense probably damaging 1.00
R3110:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3112:Zfp786 UTSW 6 47820226 missense probably damaging 1.00
R3623:Zfp786 UTSW 6 47821423 missense probably benign 0.00
R4654:Zfp786 UTSW 6 47820934 missense probably benign 0.01
R4741:Zfp786 UTSW 6 47820691 missense probably damaging 1.00
R4927:Zfp786 UTSW 6 47820153 missense probably benign 0.43
R4936:Zfp786 UTSW 6 47821268 nonsense probably null
R5084:Zfp786 UTSW 6 47820019 missense probably benign 0.00
R6662:Zfp786 UTSW 6 47826986 missense probably damaging 1.00
R7290:Zfp786 UTSW 6 47819995 missense probably damaging 1.00
R7561:Zfp786 UTSW 6 47819733 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGCTTTTGGGTGAAATGCAC -3'
(R):5'- AAAAGGGTCACATGCTCAGG -3'

Sequencing Primer
(F):5'- ACCTCTTTTTACCAAGGGAGAGG -3'
(R):5'- TCAGGCACCAGCGCATC -3'
Posted On2016-09-01